October 23, 2021

ATP4B Rabbit Polyclonal Antibody

ATP4B Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

ATP4B Polyclonal Antibody
ES10039-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATP4B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ATP4B Polyclonal Antibody
ABP57844-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of ATP4B from Human, Mouse, Rat. This ATP4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
ATP4B Polyclonal Antibody
ABP57844-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of ATP4B from Human, Mouse, Rat. This ATP4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
ATP4B Polyclonal Antibody
ABP57844-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of ATP4B from Human, Mouse, Rat. This ATP4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
ATP4B Polyclonal Antibody
A53516 100 µg
EUR 570.55
Description: The best epigenetics products
ATP4B Rabbit pAb
A10106-100ul 100 ul
EUR 308
ATP4B Rabbit pAb
A10106-200ul 200 ul
EUR 459
ATP4B Rabbit pAb
A10106-20ul 20 ul
EUR 183
ATP4B Rabbit pAb
A10106-50ul 50 ul
EUR 223
ATP4B antibody
70R-6951 50 ug
EUR 467
Description: Rabbit polyclonal ATP4B antibody raised against the middle region of ATP4B
Atp4b antibody
70R-8600 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Atp4b antibody
ATP4B Antibody
35648-100ul 100ul
EUR 252
ATP4B antibody
70R-15905 50 ul
EUR 435
Description: Rabbit polyclonal ATP4B antibody
ATP4B Antibody
1-CSB-PA002343EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA
ATP4B Antibody
1-CSB-PA002343GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ATP4B Antibody
1-CSB-PA017108
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
Polyclonal ATP4B Antibody (N-term)
APR10860G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATP4B (N-term). This antibody is tested and proven to work in the following applications:
ATP4B Polyclonal Antibody, Biotin Conjugated
A53513 100 µg
EUR 570.55
Description: Ask the seller for details
ATP4B Polyclonal Antibody, FITC Conjugated
A53514 100 µg
EUR 570.55
Description: The best epigenetics products
ATP4B Polyclonal Antibody, HRP Conjugated
A53515 100 µg
EUR 570.55
Description: kits suitable for this type of research
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
DLR-ATP4b-Hu-48T 48T
EUR 517
  • Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
DLR-ATP4b-Hu-96T 96T
EUR 673
  • Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
DLR-ATP4b-Mu-48T 48T
EUR 527
  • Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
DLR-ATP4b-Mu-96T 96T
EUR 688
  • Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
DLR-ATP4b-Ra-48T 48T
EUR 549
  • Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
DLR-ATP4b-Ra-96T 96T
EUR 718
  • Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids.
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RD-ATP4b-Hu-48Tests 48 Tests
EUR 521
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RD-ATP4b-Hu-96Tests 96 Tests
EUR 723
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RD-ATP4b-Mu-48Tests 48 Tests
EUR 533
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RD-ATP4b-Mu-96Tests 96 Tests
EUR 740
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RD-ATP4b-Ra-48Tests 48 Tests
EUR 557
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RD-ATP4b-Ra-96Tests 96 Tests
EUR 775
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RDR-ATP4b-Hu-48Tests 48 Tests
EUR 544
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RDR-ATP4b-Hu-96Tests 96 Tests
EUR 756
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RDR-ATP4b-Mu-48Tests 48 Tests
EUR 557
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RDR-ATP4b-Mu-96Tests 96 Tests
EUR 774
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RDR-ATP4b-Ra-48Tests 48 Tests
EUR 583
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit
RDR-ATP4b-Ra-96Tests 96 Tests
EUR 811
ATP4B Conjugated Antibody
C35648 100ul
EUR 397
anti- ATP4B antibody
FNab00701 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
  • Uniprot ID: P51164
  • Gene ID: 496
  • Research Area: Metabolism
Description: Antibody raised against ATP4B
Anti-ATP4B antibody
PAab00701 100 ug
EUR 355
Anti-ATP4B antibody
STJ112145 100 µl
EUR 277
Description: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase.
Anti-ATP4B antibody
STJ191197 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ATP4B
Atp4b/ Rat Atp4b ELISA Kit
ELI-24015r 96 Tests
EUR 886
ATP4B siRNA
20-abx900522
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ATP4B siRNA
20-abx908558
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ATP4B siRNA
20-abx908559
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ATP4B Antibody, HRP conjugated
1-CSB-PA002343EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ATP4B Antibody, FITC conjugated
1-CSB-PA002343EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ATP4B Antibody, Biotin conjugated
1-CSB-PA002343ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Atp4b Blocking Peptide
33R-7677 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Atp4b antibody, catalog no. 70R-8600
ATP4B Blocking Peptide
33R-7776 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATP4B antibody, catalog no. 70R-6951
ATP4B cloning plasmid
CSB-CL002343HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 876
  • Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcct
  • Show more
Description: A cloning plasmid for the ATP4B gene.
Rabbit Potassium- transporting ATPase subunit beta, ATP4B ELISA
ELI-34316Ra 96 Tests
EUR 928
Rat ATP4B shRNA Plasmid
20-abx984385
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine ATP4B ELISA KIT
ELI-24036d 96 Tests
EUR 928
ATP4B ELISA KIT|Human
EF007984 96 Tests
EUR 689
Mouse Atp4b ELISA KIT
ELI-34411m 96 Tests
EUR 865
Human ATP4B ELISA KIT
ELI-48881h 96 Tests
EUR 824
Human ATP4B shRNA Plasmid
20-abx950349
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ATP4B shRNA Plasmid
20-abx969274
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ATP4B Recombinant Protein (Human)
RP002296 100 ug Ask for price
pCMV-SPORT6-ATP4B Plasmid
PVT16366 2 ug
EUR 325
ATP4B Recombinant Protein (Rat)
RP191456 100 ug Ask for price
ATP4B Recombinant Protein (Mouse)
RP117971 100 ug Ask for price
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit
E04P0799-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit
E04P0799-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit
E04P0799-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Anti-Hydrogen Potassium ATPase Beta/ATP4B Antibody
A08719-1 100ug/vial
EUR 294
ATP4B ORF Vector (Human) (pORF)
ORF000766 1.0 ug DNA
EUR 95
Atp4b ORF Vector (Mouse) (pORF)
ORF039325 1.0 ug DNA
EUR 506
Atp4b ORF Vector (Rat) (pORF)
ORF063820 1.0 ug DNA
EUR 506
ATP4b ELISA Kit (Mouse) (OKDD00766)
OKDD00766 96 Wells
EUR 988
Description: Description of target: Required for stabilization and maturation of the catalytic proton pump alpha subunit and may also involved in cell adhesion and establishing epithelial cell polarity.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.066ng/mL
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
20-abx111155
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
20-abx110108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
20-abx136016
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
abx037938-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
abx032433-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
abx032433-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody
20-abx175505
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody
20-abx175506
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
20-abx214013
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody
abx230701-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
ATP4B sgRNA CRISPR Lentivector set (Human)
K0146701 3 x 1.0 ug
EUR 339
Atp4b sgRNA CRISPR Lentivector set (Mouse)
K3780701 3 x 1.0 ug
EUR 339
Atp4b sgRNA CRISPR Lentivector set (Rat)
K6902401 3 x 1.0 ug
EUR 339
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (HRP)
20-abx108624
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (Biotin)
20-abx105786
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (FITC)
20-abx107204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ATP4B sgRNA CRISPR Lentivector (Human) (Target 1)
K0146702 1.0 ug DNA
EUR 154
ATP4B sgRNA CRISPR Lentivector (Human) (Target 2)
K0146703 1.0 ug DNA
EUR 154
ATP4B sgRNA CRISPR Lentivector (Human) (Target 3)
K0146704 1.0 ug DNA
EUR 154
Human Potassium-transporting ATPase subunit beta (ATP4B)
1-CSB-YP002343HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in Yeast
Human Potassium-transporting ATPase subunit beta (ATP4B)
1-CSB-EP002343HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in E.coli
Human Potassium-transporting ATPase subunit beta (ATP4B)
1-CSB-EP002343HUe1
  • EUR 496.00
  • EUR 330.00
  • EUR 1425.00
  • EUR 677.00
  • EUR 989.00
  • EUR 378.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),Partial expressed in E.coli
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3780702 1.0 ug DNA
EUR 154
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3780703 1.0 ug DNA
EUR 154
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3780704 1.0 ug DNA
EUR 154
ATP4B Protein Vector (Human) (pPB-C-His)
PV003061 500 ng
EUR 329
ATP4B Protein Vector (Human) (pPB-N-His)
PV003062 500 ng
EUR 329
ATP4B Protein Vector (Human) (pPM-C-HA)
PV003063 500 ng
EUR 329
ATP4B Protein Vector (Human) (pPM-C-His)
PV003064 500 ng
EUR 329
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6902402 1.0 ug DNA
EUR 154
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6902403 1.0 ug DNA
EUR 154
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6902404 1.0 ug DNA
EUR 154
ATP4B Protein Vector (Human) (pPB-His-MBP)
PV325046 500 ng
EUR 329
ATP4B Protein Vector (Human) (pPB-His-GST)
PV325047 500 ng
EUR 329
ATP4B Protein Vector (Rat) (pPB-C-His)
PV255278 500 ng
EUR 603
ATP4B Protein Vector (Rat) (pPB-N-His)
PV255279 500 ng
EUR 603
ATP4B Protein Vector (Rat) (pPM-C-HA)
PV255280 500 ng
EUR 603
ATP4B Protein Vector (Rat) (pPM-C-His)
PV255281 500 ng
EUR 603
ATP4B Protein Vector (Mouse) (pPB-C-His)
PV157298 500 ng
EUR 603
ATP4B Protein Vector (Mouse) (pPB-N-His)
PV157299 500 ng
EUR 603
ATP4B Protein Vector (Mouse) (pPM-C-HA)
PV157300 500 ng
EUR 603
ATP4B Protein Vector (Mouse) (pPM-C-His)
PV157301 500 ng
EUR 603
Atp4b 3'UTR Luciferase Stable Cell Line
TU201076 1.0 ml Ask for price
Atp4b 3'UTR GFP Stable Cell Line
TU152320 1.0 ml Ask for price
ATP4B 3'UTR Luciferase Stable Cell Line
TU001389 1.0 ml
EUR 1394
Atp4b 3'UTR Luciferase Stable Cell Line
TU102320 1.0 ml Ask for price
ATP4B 3'UTR GFP Stable Cell Line
TU051389 1.0 ml
EUR 1394
Atp4b 3'UTR GFP Stable Cell Line
TU251076 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATP4B Rabbit Polyclonal Antibody