October 26, 2021

SH2B3 Rabbit Polyclonal Antibody

SH2B3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SH2B3 Polyclonal Antibody
ES10242-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SH2B3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
SH2B3 Polyclonal Antibody
ABP60389-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SH2B3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SH2B3 from Human. This SH2B3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SH2B3 protein
SH2B3 Polyclonal Antibody
ABP60389-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SH2B3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SH2B3 from Human. This SH2B3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SH2B3 protein
SH2B3 Polyclonal Antibody
ABP60389-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SH2B3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SH2B3 from Human. This SH2B3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SH2B3 protein
SH2B3 Antibody
ABD9898 100 ug
EUR 438
SH2B3 Antibody
46231-100ul 100ul
EUR 252
SH2B3 Antibody
46231-50ul 50ul
EUR 187
SH2B3 antibody
10R-7180 100 ul
EUR 691
Description: Mouse monoclonal SH2B3 antibody
SH2B3 antibody
10R-5756 100 ul
EUR 691
Description: Mouse monoclonal SH2B3 antibody
SH2B3 antibody
10R-5757 100 ul
EUR 691
Description: Mouse monoclonal SH2B3 antibody
SH2B3 antibody
10R-5758 100 ul
EUR 691
Description: Mouse monoclonal SH2B3 antibody
SH2B3 Antibody
DF9898 200ul
EUR 304
Description: SH2B3 Antibody detects endogenous levels of total SH2B3.
Sh2b3/ Rat Sh2b3 ELISA Kit
ELI-39350r 96 Tests
EUR 886
Polyclonal Goat Anti-LNK / SH2B3 Antibody
APR16324G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LNK / SH2B3 . This antibody is tested and proven to work in the following applications:
SH2B3 Conjugated Antibody
C46231 100ul
EUR 397
Anti-SH2B3 antibody
STJ191400 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SH2B3
SH2B3 siRNA
20-abx904906
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SH2B3 siRNA
20-abx933198
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SH2B3 siRNA
20-abx933199
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-LNK / SH2B3 antibody
STJ70582 100 µg
EUR 359
SH2B3 Blocking Peptide
DF9898-BP 1mg
EUR 195
SH2B3 cloning plasmid
CSB-CL892371HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 156
  • Sequence: atggagtttctcttgtcaaccgggctggagtgcagtggtgcaatcttggctcactgcaacctccaccttcctggttcaagcgattctgcctcgacctctcaagtagctgggattacaagcaccagccaccatgcctggctaattttgtatttttag
Description: A cloning plasmid for the SH2B3 gene.
Rabbit Anti-Mouse lymphocyte specific adaptor protein Lnk (SH2B3) (SH2B3- phospho) IgG (aff pure)
AB-23116-A 100ug
EUR 482
Rabbit Anti-Mouse lymphocyte specific adaptor protein Lnk (SH2B3) (SH2B3- phospho) IgG (aff pure)
AB-23117-A 100ug
EUR 482
Rat SH2B3 shRNA Plasmid
20-abx985908
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SH2B3 shRNA Plasmid
20-abx956746
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SH2B3 shRNA Plasmid
20-abx971341
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SH2B3 Recombinant Protein (Human)
RP028411 100 ug Ask for price
SH2B3 Recombinant Protein (Rat)
RP228512 100 ug Ask for price

SH2B3 Rabbit Polyclonal Antibody