October 26, 2021

SFTPD Rabbit Polyclonal Antibody

SFTPD Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SFTPD Polyclonal Antibody

ABP60380-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370

SFTPD Rabbit pAb

A1651-100ul 100 ul
EUR 308

SFTPD Rabbit pAb

A1651-200ul 200 ul
EUR 459

SFTPD Rabbit pAb

A1651-20ul 20 ul
EUR 183

SFTPD Rabbit pAb

A1651-50ul 50 ul
EUR 223

SFTPD antibody

70R-5911 50 ug
EUR 467
Description: Rabbit polyclonal SFTPD antibody raised against the middle region of SFTPD

SFTPD Antibody

35929-100ul 100ul
EUR 252

SFTPD antibody

70R-20217 50 ul
EUR 435
Description: Rabbit polyclonal SFTPD antibody

SFTPD Antibody

1-CSB-PA924520
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SFTPD Antibody

1-CSB-PA820032
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SFTPD Antibody

1-CSB-PA021175GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal SFTPD Antibody (C-term)

AMR09891G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFTPD (C-term). This antibody is tested and proven to work in the following applications:

SFTPD Conjugated Antibody

C35929 100ul
EUR 397

Anti-SFTPD antibody

STJ116154 100 µl
EUR 277
Description: The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism.

Anti-SFTPD antibody

STJ191230 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SFTPD

SFTPD siRNA

20-abx904892
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFTPD siRNA

20-abx933134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFTPD siRNA

20-abx933135
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SFTPD cloning plasmid

CSB-CL021175HU-10ug 10ug
EUR 426
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atgctgctcttcctcctctctgcactggtcctgctcacacagcccctgggctacctggaagcaggaatgaagacctactcccacagaacaatgcccagtgcttgcaccctggtcatgtgtagctcagtggagagtggcctgcctggtcgcgatggacgggatgggagagagggcc
  • Show more
Description: A cloning plasmid for the SFTPD gene.

SFTPD, human recombinant

7328-100
EUR 387

SFTPD Blocking Peptide

33R-7253 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFTPD antibody, catalog no. 70R-5911

Surfactant Protein D (SFTPD) Antibody

20-abx115918
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody

abx027729-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody

abx027729-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody

20-abx339748
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody

20-abx339749
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody

abx414524-025mg 0.25 mg
EUR 592
  • Shipped within 1 week.

Surfactant Protein D (SFTPD) Antibody

abx238401-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-Surfactant protein D/SFTPD Antibody

PB9617 100ug/vial
EUR 334

Rat SFTPD shRNA Plasmid

20-abx984952
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SFTPD Rabbit Polyclonal Antibody