NUP62 Rabbit Polyclonal Antibody

NUP62 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NUP62 Polyclonal Antibody
ES9942-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NUP62 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Nucleoporin 62kDa (NUP62) ELISA Kit
DLR-NUP62-Hu-48T	DL Develop	48T	EUR 517
Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit
DLR-NUP62-Hu-96T	DL Develop	96T	EUR 673
Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit
RDR-NUP62-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Nucleoporin 62kDa (NUP62) ELISA Kit
RDR-NUP62-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Nucleoporin 62kDa (NUP62) ELISA Kit
RD-NUP62-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Nucleoporin 62kDa (NUP62) ELISA Kit
RD-NUP62-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

NUP62 Rabbit pAb
A2499-100ul	Abclonal	100 ul	EUR 308

NUP62 Rabbit pAb
A2499-200ul	Abclonal	200 ul	EUR 459

NUP62 Rabbit pAb
A2499-20ul	Abclonal	20 ul	EUR 183

NUP62 Rabbit pAb
A2499-50ul	Abclonal	50 ul	EUR 223

NUP62 antibody
70R-19006	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NUP62 antibody

NUP62 antibody
70R-2086	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NUP62 antibody raised against the N terminal of NUP62

NUP62 Antibody
32676-100ul	SAB	100ul	EUR 252

NUP62 Antibody
DF6968	Affbiotech	200ul	EUR 304
Description: NUP62 Antibody detects endogenous levels of total NUP62.

NUP62 Antibody
1-CSB-PA255769	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NUP62 Antibody
1-CSB-PA016204GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUP62 Antibody
1-CSB-PA016204LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000

NUP62 Antibody
1-CSB-PA041313	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NUP62 Antibody
ABD6968	Lifescience Market	100 ug	EUR 438

Polyclonal NUP62 Antibody (C-Term)
APG00435G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NUP62 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal NUP62 Antibody (C-term E507)
APR05916G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP62 (C-term E507). This antibody is tested and proven to work in the following applications:

NUP62 Conjugated Antibody
C32676	SAB	100ul	EUR 397

anti- NUP62 antibody
FNab05927	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000 - 1:2000 IHC: 1:50 - 1:200 Immunogen: nucleoporin 62kDa Uniprot ID: P37198 Gene ID: 23636 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP62

Anti-NUP62 antibody
PAab05927	Lifescience Market	100 ug	EUR 355

Anti-NUP62 antibody
STJ24850	St John's Laboratory	100 µl	EUR 277
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform.

Anti-NUP62 antibody
STJ70481	St John's Laboratory	100 µg	EUR 260

Anti-NUP62 antibody
STJ191100	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NUP62

Nup62/ Rat Nup62 ELISA Kit
ELI-13774r	Lifescience Market	96 Tests	EUR 886

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig)
4-PAC257Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62)

NUP62 siRNA
20-abx903709	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP62 siRNA
20-abx926643	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP62 siRNA
20-abx926644	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NUP62 Antibody, HRP conjugated
1-CSB-PA016204LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP62 Antibody, FITC conjugated
1-CSB-PA016204LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP62 Antibody, Biotin conjugated
1-CSB-PA016204LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nucleoporin 62 (NUP62) Antibody
20-abx142112	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody
abx033433-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody
abx033433-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody
abx235927-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Nucleoporin 62 (NUP62) Antibody
abx433060-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Nucleoporin 62 (NUP62) Antibody
20-abx001943	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), APC
4-PAC257Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with APC.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), Biotinylated
4-PAC257Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with Biotin.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), Cy3
4-PAC257Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with Cy3.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), FITC
4-PAC257Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with FITC.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), HRP
4-PAC257Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with HRP.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), PE
4-PAC257Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with PE.

Rabbit Nucleoporin 62 kDa (NUP62) ELISA Kit
abx362930-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

NUP62 Blocking Peptide
33R-8456	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP62 antibody, catalog no. 70R-2086

NUP62 Blocking Peptide
DF6968-BP	Affbiotech	1mg	EUR 195

NUP62 cloning plasmid
CSB-CL016204HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1569 Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc Show more
Description: A cloning plasmid for the NUP62 gene.

NUP62 cloning plasmid
CSB-CL016204HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1569 Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc Show more
Description: A cloning plasmid for the NUP62 gene.

Nucleoporin 62 kDa (NUP62) Antibody
20-abx114230	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 62 kDa (NUP62) Antibody
20-abx128968	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nucleoporin 62 kDa (NUP62) Antibody
20-abx173878	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Nucleoporin 62 kDa (NUP62) Antibody
20-abx242160	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 62 kDa (NUP62) Antibody
20-abx242161	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), APC-Cy7
4-PAC257Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NUP62 (Ala186~Lys432) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with APC-Cy7.

NUP62 ELISA KIT|Human
EF007020	Lifescience Market	96 Tests	EUR 689

Mouse NUP62 shRNA Plasmid
20-abx971843	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NUP62 shRNA Plasmid
20-abx986442	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NUP62 shRNA Plasmid
20-abx958412	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Nucleoporin 62kDa (NUP62)
4-RPC257Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P37198 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.0kDa Isoelectric Point: 5.8
Description: Recombinant Human Nucleoporin 62kDa expressed in: E.coli

Recombinant Nucleoporin 62 (NUP62)
4-RPC257Ra01	Cloud-Clone	EUR 530.08 EUR 245.00 EUR 1712.80 EUR 637.60 EUR 1175.20 EUR 418.00 EUR 4132.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P17955 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.7kDa Isoelectric Point: 5
Description: Recombinant Rat Nucleoporin 62 expressed in: E.coli

pCMV-SPORT6-NUP62 Plasmid
PVT16158	Lifescience Market	2 ug	EUR 325

NUP62 Recombinant Protein (Human)
RP021928	ABM	100 ug	Ask for price

NUP62 Recombinant Protein (Human)
RP021931	ABM	100 ug	Ask for price

NUP62 Recombinant Protein (Mouse)
RP155507	ABM	100 ug	Ask for price

NUP62 Recombinant Protein (Rat)
RP214868	ABM	100 ug	Ask for price

Monoclonal NUP62 Antibody (monoclonal) (M01), Clone: 1F12
AMM03869G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NUP62 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F12. This antibody is applicable in WB, E

Monoclonal NUP62 Antibody (monoclonal) (M02), Clone: 2D3
AMM03870G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human NUP62 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB and IF

NUP62 Rabbit Polyclonal Antibody