January 17, 2022

NUP62 Rabbit Polyclonal Antibody

NUP62 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NUP62 Polyclonal Antibody

ES9942-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NUP62 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Nucleoporin 62kDa (NUP62) ELISA Kit

DLR-NUP62-Hu-48T 48T
EUR 517
  • Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

DLR-NUP62-Hu-96T 96T
EUR 673
  • Should the Human Nucleoporin 62kDa (NUP62) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nucleoporin 62kDa (NUP62) in samples from tissue homogenates or other biological fluids.

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RDR-NUP62-Hu-48Tests 48 Tests
EUR 544

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RDR-NUP62-Hu-96Tests 96 Tests
EUR 756

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RD-NUP62-Hu-48Tests 48 Tests
EUR 521

Human Nucleoporin 62kDa (NUP62) ELISA Kit

RD-NUP62-Hu-96Tests 96 Tests
EUR 723

NUP62 Rabbit pAb

A2499-100ul 100 ul
EUR 308

NUP62 Rabbit pAb

A2499-200ul 200 ul
EUR 459

NUP62 Rabbit pAb

A2499-20ul 20 ul
EUR 183

NUP62 Rabbit pAb

A2499-50ul 50 ul
EUR 223

NUP62 antibody

70R-19006 50 ul
EUR 435
Description: Rabbit polyclonal NUP62 antibody

NUP62 antibody

70R-2086 50 ug
EUR 467
Description: Rabbit polyclonal NUP62 antibody raised against the N terminal of NUP62

NUP62 Antibody

32676-100ul 100ul
EUR 252

NUP62 Antibody

DF6968 200ul
EUR 304
Description: NUP62 Antibody detects endogenous levels of total NUP62.

NUP62 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NUP62 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUP62 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000

NUP62 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NUP62 Antibody

ABD6968 100 ug
EUR 438

Polyclonal NUP62 Antibody (C-Term)

APG00435G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NUP62 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal NUP62 Antibody (C-term E507)

APR05916G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP62 (C-term E507). This antibody is tested and proven to work in the following applications:

NUP62 Conjugated Antibody

C32676 100ul
EUR 397

anti- NUP62 antibody

FNab05927 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: nucleoporin 62kDa
  • Uniprot ID: P37198
  • Gene ID: 23636
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP62

Anti-NUP62 antibody

PAab05927 100 ug
EUR 355

Anti-NUP62 antibody

STJ24850 100 µl
EUR 277
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins and is localized to the nuclear pore central plug. This protein associates with the importin alpha/beta complex which is involved in the import of proteins containing nuclear localization signals. Multiple transcript variants of this gene encode a single protein isoform.

Anti-NUP62 antibody

STJ70481 100 µg
EUR 260

Anti-NUP62 antibody

STJ191100 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NUP62

Nup62/ Rat Nup62 ELISA Kit

ELI-13774r 96 Tests
EUR 886

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP62 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP62 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP62 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP62. Recognizes NUP62 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nucleoporin 62 (NUP62) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody

abx033433-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody

abx033433-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nucleoporin 62 (NUP62) Antibody

abx235927-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nucleoporin 62 (NUP62) Antibody

abx433060-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Nucleoporin 62 (NUP62) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with APC.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with Biotin.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with Cy3.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with FITC.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with HRP.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with PE.

Rabbit Nucleoporin 62 kDa (NUP62) ELISA Kit

abx362930-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

NUP62 Blocking Peptide

33R-8456 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NUP62 antibody, catalog no. 70R-2086

NUP62 Blocking Peptide

DF6968-BP 1mg
EUR 195

NUP62 cloning plasmid

CSB-CL016204HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc
  • Show more
Description: A cloning plasmid for the NUP62 gene.

NUP62 cloning plasmid

CSB-CL016204HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1569
  • Sequence: atgagcgggtttaattttggaggcactggggcccctacaggcgggttcacgtttggcactgcaaagacggcaacaaccacacctgctacagggttttctttctccacctctggcactggagggtttaattttggggctcccttccaaccagccacaagtaccccttccaccggcc
  • Show more
Description: A cloning plasmid for the NUP62 gene.

Nucleoporin 62 kDa (NUP62) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62 kDa (NUP62) Antibody

  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 62 kDa (NUP62) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nucleoporin 62 kDa (NUP62) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62 kDa (NUP62) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 62kDa (NUP62) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP62 (Ala186~Lys432)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Nucleoporin 62kDa (NUP62). This antibody is labeled with APC-Cy7.


EF007020 96 Tests
EUR 689

Mouse NUP62 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NUP62 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NUP62 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Nucleoporin 62kDa (NUP62)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P37198
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.0kDa
  • Isoelectric Point: 5.8
Description: Recombinant Human Nucleoporin 62kDa expressed in: E.coli

Recombinant Nucleoporin 62 (NUP62)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17955
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.7kDa
  • Isoelectric Point: 5
Description: Recombinant Rat Nucleoporin 62 expressed in: E.coli

pCMV-SPORT6-NUP62 Plasmid

PVT16158 2 ug
EUR 325

NUP62 Recombinant Protein (Human)

RP021928 100 ug Ask for price

NUP62 Recombinant Protein (Human)

RP021931 100 ug Ask for price

NUP62 Recombinant Protein (Mouse)

RP155507 100 ug Ask for price

NUP62 Recombinant Protein (Rat)

RP214868 100 ug Ask for price

Monoclonal NUP62 Antibody (monoclonal) (M01), Clone: 1F12

AMM03869G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NUP62 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1F12. This antibody is applicable in WB, E

Monoclonal NUP62 Antibody (monoclonal) (M02), Clone: 2D3

AMM03870G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NUP62 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2D3. This antibody is applicable in WB and IF

NUP62 Rabbit Polyclonal Antibody