October 26, 2021

PNKD Rabbit Polyclonal Antibody

PNKD Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PNKD Polyclonal Antibody
31468-50ul 50ul
EUR 187
PNKD Polyclonal Antibody
ABP59960-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
PNKD Polyclonal Antibody
ABP59960-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
PNKD Polyclonal Antibody
ABP59960-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of PNKD from Human, Mouse. This PNKD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PNKD protein at amino acid sequence of 140-220
PNKD Polyclonal Antibody
ES10050-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PNKD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PNKD Polyclonal Antibody
ES10050-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PNKD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PNKD Rabbit pAb
A8203-100ul 100 ul
EUR 308
PNKD Rabbit pAb
A8203-200ul 200 ul
EUR 459
PNKD Rabbit pAb
A8203-20ul 20 ul
EUR 183
PNKD Rabbit pAb
A8203-50ul 50 ul
EUR 223
PNKD Polyclonal Conjugated Antibody
C31468 100ul
EUR 397
Probable Hydrolase PNKD (PNKD) Antibody
abx026892-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Probable Hydrolase PNKD (PNKD) Antibody
abx026892-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Probable Hydrolase PNKD (PNKD) Antibody
abx036151-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Probable Hydrolase PNKD (PNKD) Antibody
abx236582-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Probable Hydrolase PNKD (PNKD) Antibody
20-abx318048
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
PNKD antibody
70R-19375 50 ul
EUR 435
Description: Rabbit polyclonal PNKD antibody
PNKD Antibody
39834-100ul 100ul
EUR 390
PNKD Antibody
1-CSB-PA843154LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
PNKD Antibody
1-CSB-PA018260GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
PNKD antibody
70R-35856 100 ug
EUR 349
Description: Rabbit polyclonal PNKD antibody
Pnkd antibody
70R-8613 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Pnkd antibody
Probable Hydrolase PNKD (PNKD) Antibody (HRP)
20-abx315475
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Probable Hydrolase PNKD (PNKD) Antibody (FITC)
20-abx315476
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Probable Hydrolase PNKD (PNKD) Antibody (Biotin)
20-abx315477
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
anti- PNKD antibody
FNab06582 100µg
EUR 505.25
  • Immunogen: paroxysmal nonkinesigenic dyskinesia
  • Uniprot ID: Q8N490
  • Gene ID: 25953
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against PNKD
Anti-PNKD antibody
PAab06582 100 ug
EUR 355
Anti-PNKD antibody
STJ117854 100 µl
EUR 277
Description: This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants.
Anti-PNKD antibody
STJ191208 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PNKD
PNKD siRNA
20-abx929060
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PNKD siRNA
20-abx929061
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-PNKD
YF-PA27528 50 ug
EUR 363
Description: Mouse polyclonal to PNKD
PNKD Antibody, HRP conjugated
1-CSB-PA843154LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PNKD Antibody, FITC conjugated
1-CSB-PA843154LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PNKD Antibody, Biotin conjugated
1-CSB-PA843154LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PNKD. Recognizes PNKD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Bovine Probable hydrolase PNKD, PNKD ELISA KIT
ELI-43539b 96 Tests
EUR 928
Mouse Probable hydrolase PNKD, Pnkd ELISA KIT
ELI-43540m 96 Tests
EUR 865
Human Probable hydrolase PNKD (PNKD) ELISA Kit
abx382321-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Probable hydrolase PNKD (PNKD) ELISA Kit
abx390160-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Probable hydrolase PNKD, PNKD ELISA KIT
ELI-36132h 96 Tests
EUR 824
Pnkd Blocking Peptide
33R-5615 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Pnkd antibody, catalog no. 70R-8613
PNKD cloning plasmid
CSB-CL843154HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1086
  • Sequence: atggcttggcagggctggcccgcggcgtggcagtgggtcgccggctgctggctcctcctcgtccttgtcctcgtcctacttgtgagcccccgcggctgccgagcgcggcggggcctccgcggtctgctcatggcgcacagccagcggctgctcttccgaatcgggtacagcctgt
  • Show more
Description: A cloning plasmid for the PNKD gene.
PNKD cloning plasmid
CSB-CL843154HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1158
  • Sequence: atggcggcggtggtagctgctacggcgctgaagagccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggtttctcataacaggacccgggccctgcaaagccacagctcctcagagggcaaggaggaacctgaacccctatccccgg
  • Show more
Description: A cloning plasmid for the PNKD gene.
PNKD cloning plasmid
CSB-CL843154HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atggcggcggtggtagctgctacggcgctgaagggccggggggcgagaaatgcccgcgtcctccgggggattctcgcaggagccacagctaacaaggcttctcataacaggacccgggccctgcaaagccacagctccccagagggcaaggaggaacctgaacccctatccccgga
  • Show more
Description: A cloning plasmid for the PNKD gene.
Pnkd ELISA Kit| Mouse Probable hydrolase PNKD ELISA Kit
EF015799 96 Tests
EUR 689
PNKD ELISA Kit| Bovine Probable hydrolase PNKD ELISA Kit
EF011715 96 Tests
EUR 689
PNKD ELISA KIT|Human
EF001893 96 Tests
EUR 689
Mouse PNKD shRNA Plasmid
20-abx974862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PNKD shRNA Plasmid
20-abx958613
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PNKD Recombinant Protein (Human)
RP023923 100 ug Ask for price
PNKD Recombinant Protein (Human)
RP023926 100 ug Ask for price
PNKD Recombinant Protein (Human)
RP023929 100 ug Ask for price
PNKD Recombinant Protein (Mouse)
RP163112 100 ug Ask for price
PNKD Recombinant Protein (Mouse)
RP163115 100 ug Ask for price
PNKD Recombinant Protein (Mouse)
RP163118 100 ug Ask for price
PNKD Recombinant Protein (Rat)
RP221156 100 ug Ask for price
PNKD Recombinant Protein (Rat)
RP221159 100 ug Ask for price
PNKD Recombinant Protein (Rat)
RP221162 100 ug Ask for price
Pnkd ORF Vector (Rat) (pORF)
ORF073720 1.0 ug DNA
EUR 506
Pnkd ORF Vector (Rat) (pORF)
ORF073721 1.0 ug DNA
EUR 506
Pnkd ORF Vector (Rat) (pORF)
ORF073722 1.0 ug DNA
EUR 506
PNKD ORF Vector (Human) (pORF)
ORF007975 1.0 ug DNA
EUR 95
PNKD ORF Vector (Human) (pORF)
ORF007976 1.0 ug DNA
EUR 95
PNKD ORF Vector (Human) (pORF)
ORF007977 1.0 ug DNA
EUR 95
Pnkd ORF Vector (Mouse) (pORF)
ORF054372 1.0 ug DNA
EUR 506
Pnkd ORF Vector (Mouse) (pORF)
ORF054373 1.0 ug DNA
EUR 506
Pnkd ORF Vector (Mouse) (pORF)
ORF054374 1.0 ug DNA
EUR 506
Pnkd sgRNA CRISPR Lentivector set (Mouse)
K4860101 3 x 1.0 ug
EUR 339
Pnkd sgRNA CRISPR Lentivector set (Rat)
K7520901 3 x 1.0 ug
EUR 339
PNKD sgRNA CRISPR Lentivector set (Human)
K1675901 3 x 1.0 ug
EUR 339
Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4860102 1.0 ug DNA
EUR 154
Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4860103 1.0 ug DNA
EUR 154
Pnkd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4860104 1.0 ug DNA
EUR 154
Pnkd sgRNA CRISPR Lentivector (Rat) (Target 1)
K7520902 1.0 ug DNA
EUR 154
Pnkd sgRNA CRISPR Lentivector (Rat) (Target 2)
K7520903 1.0 ug DNA
EUR 154
Pnkd sgRNA CRISPR Lentivector (Rat) (Target 3)
K7520904 1.0 ug DNA
EUR 154
PNKD sgRNA CRISPR Lentivector (Human) (Target 1)
K1675902 1.0 ug DNA
EUR 154
PNKD sgRNA CRISPR Lentivector (Human) (Target 2)
K1675903 1.0 ug DNA
EUR 154
PNKD sgRNA CRISPR Lentivector (Human) (Target 3)
K1675904 1.0 ug DNA
EUR 154
PNKD Protein Vector (Rat) (pPB-C-His)
PV294878 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPB-N-His)
PV294879 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPM-C-HA)
PV294880 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPM-C-His)
PV294881 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPB-C-His)
PV294882 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPB-N-His)
PV294883 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPM-C-HA)
PV294884 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPM-C-His)
PV294885 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPB-C-His)
PV294886 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPB-N-His)
PV294887 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPM-C-HA)
PV294888 500 ng
EUR 603
PNKD Protein Vector (Rat) (pPM-C-His)
PV294889 500 ng
EUR 603
PNKD Protein Vector (Human) (pPB-C-His)
PV031897 500 ng
EUR 329
PNKD Protein Vector (Human) (pPB-N-His)
PV031898 500 ng
EUR 329
PNKD Protein Vector (Human) (pPM-C-HA)
PV031899 500 ng
EUR 329
PNKD Protein Vector (Human) (pPM-C-His)
PV031900 500 ng
EUR 329
PNKD Protein Vector (Human) (pPB-C-His)
PV031901 500 ng
EUR 329
PNKD Protein Vector (Human) (pPB-N-His)
PV031902 500 ng
EUR 329
PNKD Protein Vector (Human) (pPM-C-HA)
PV031903 500 ng
EUR 329
PNKD Protein Vector (Human) (pPM-C-His)
PV031904 500 ng
EUR 329
PNKD Protein Vector (Human) (pPB-C-His)
PV031905 500 ng
EUR 329
PNKD Protein Vector (Human) (pPB-N-His)
PV031906 500 ng
EUR 329
PNKD Protein Vector (Human) (pPM-C-HA)
PV031907 500 ng
EUR 329
PNKD Protein Vector (Human) (pPM-C-His)
PV031908 500 ng
EUR 329
PNKD Protein Vector (Mouse) (pPB-C-His)
PV217486 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPB-N-His)
PV217487 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPM-C-HA)
PV217488 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPM-C-His)
PV217489 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPB-C-His)
PV217490 500 ng
EUR 603
PNKD Protein Vector (Mouse) (pPB-N-His)
PV217491 500 ng
EUR 603
PNKD Protein Vector (Mouse) (pPM-C-HA)
PV217492 500 ng
EUR 603
PNKD Protein Vector (Mouse) (pPM-C-His)
PV217493 500 ng
EUR 603
PNKD Protein Vector (Mouse) (pPB-C-His)
PV217494 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPB-N-His)
PV217495 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPM-C-HA)
PV217496 500 ng
EUR 1065
PNKD Protein Vector (Mouse) (pPM-C-His)
PV217497 500 ng
EUR 1065
Pnkd 3'UTR Luciferase Stable Cell Line
TU116611 1.0 ml Ask for price
Pnkd 3'UTR GFP Stable Cell Line
TU166611 1.0 ml Ask for price
Pnkd 3'UTR Luciferase Stable Cell Line
TU216465 1.0 ml Ask for price
Pnkd 3'UTR GFP Stable Cell Line
TU266465 1.0 ml Ask for price
PNKD 3'UTR GFP Stable Cell Line
TU068346 1.0 ml
EUR 1521
PNKD 3'UTR Luciferase Stable Cell Line
TU018346 1.0 ml
EUR 1521
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

PNKD Rabbit Polyclonal Antibody