October 23, 2021

RRAS2 Rabbit Polyclonal Antibody

RRAS2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

Polyclonal RRAS2 Antibody
APR06809G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RRAS2 . This antibody is tested and proven to work in the following applications:
RRAS2 Polyclonal Antibody
ABP60259-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
RRAS2 Polyclonal Antibody
ABP60259-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
RRAS2 Polyclonal Antibody
ABP60259-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
  • Applications tips:
Description: A polyclonal antibody for detection of RRAS2 from Human, Mouse. This RRAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAS2 protein at amino acid sequence of 90-170
RRAS2 Polyclonal Antibody
ES10138-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RRAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RRAS2 Polyclonal Antibody
ES10138-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RRAS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RRAS2 Rabbit pAb
A7076-100ul 100 ul
EUR 308
RRAS2 Rabbit pAb
A7076-200ul 200 ul
EUR 459
RRAS2 Rabbit pAb
A7076-20ul 20 ul
EUR 183
RRAS2 Rabbit pAb
A7076-50ul 50 ul
EUR 223
RRAS2 antibody
70R-20023 50 ul
EUR 435
Description: Rabbit polyclonal RRAS2 antibody
RRAS2 Antibody
40328-100ul 100ul
EUR 252
RRAS2 Antibody
DF9840 200ul
EUR 304
Description: RRAS2 Antibody detects endogenous levels of total RRAS2.
RRAS2 Antibody
1-CSB-PA350769
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
RRAS2 antibody
70R-50868 100 ul
EUR 244
Description: Purified Polyclonal RRAS2 antibody
RRAS2 Antibody
1-CSB-PA020514ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
RRAS2 Antibody
1-CSB-PA020514GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RRAS2. Recognizes RRAS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
RRAS2 Antibody
ABD9840 100 ug
EUR 438
Human RRAS2 Antibody
32052-05111 150 ug
EUR 261
RRAS2 Conjugated Antibody
C40328 100ul
EUR 397
anti- RRAS2 antibody
FNab07490 100µg
EUR 548.75
  • Immunogen: related RAS viral(r-ras) oncogene homolog 2
  • Uniprot ID: P62070
  • Gene ID: 22800
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against RRAS2
Anti-RRAS2 antibody
PAab07490 100 ug
EUR 386
Anti-RRAS2 antibody
STJ11100659 50 µl
EUR 287
Description: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants.
Anti-RRAS2 antibody
STJ29156 100 µl
EUR 277
Description: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants.
Anti-RRAS2 antibody
STJ191296 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RRAS2
RRAS2 siRNA
20-abx932142
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RRAS2 siRNA
20-abx932143
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-RRAS2
YF-PA17610 50 ul
EUR 363
Description: Mouse polyclonal to RRAS2
anti-RRAS2
YF-PA17611 100 ug
EUR 403
Description: Rabbit polyclonal to RRAS2
RRAS2 Blocking Peptide
DF9840-BP 1mg
EUR 195
RRAS2 Blocking Peptide
20-abx063743
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RRAS2 cloning plasmid
CSB-CL020514HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 615
  • Sequence: atggccgcggccggctggcgggacggctccggccaggagaagtaccggctcgtggtggtcggcgggggcggcgtgggcaagtcggcgctcaccatccagttcatccagtcctattttgtaacggattatgatccaaccattgaagattcttacacaaagcagtgtgtgatagatga
  • Show more
Description: A cloning plasmid for the RRAS2 gene.
RRAS2 Mouse mAb
A19466-100ul 100 ul Ask for price
RRAS2 Mouse mAb
A19466-200ul 200 ul Ask for price
RRAS2 Mouse mAb
A19466-20ul 20 ul Ask for price
RRAS2 Mouse mAb
A19466-50ul 50 ul
EUR 308
pCMV-SPORT6-RRAS2
PVT14216 2 ug
EUR 495
Human RRAS2 Antibody (Biotin Conjugate)
32052-05121 150 ug
EUR 369
Monoclonal RRAS2 Antibody, Clone: 1578CT130.349.47.14
AMM02539G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RRAS2. The antibodies are raised in Mouse and are from clone 1578CT130.349.47.14. This antibody is applicable in WB, E
RRAS2 protein (His tag)
80R-1201 100 ug
EUR 224
Description: Purified recombinant Human RRAS2 protein
RRAS2 ELISA KIT|Human
EF002645 96 Tests
EUR 689
Mouse RRAS2 shRNA Plasmid
20-abx975862
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RRAS2 shRNA Plasmid
20-abx957779
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti-RRAS2 (2D3-4B8)
LF-MA10287 50 ug
EUR 363
Description: Mouse monoclonal to RRAS2
RRAS2 Recombinant Protein (Human)
RP027277 100 ug Ask for price
RRAS2 Recombinant Protein (Mouse)
RP169358 100 ug Ask for price
RRAS2 Recombinant Protein (Rat)
RP226943 100 ug Ask for price
Anti-RRAS2 (2D3-4B8)
YF-MA17732 200 ul
EUR 363
Description: Mouse monoclonal to RRAS2
Human RRAS2 AssayLite Antibody (FITC Conjugate)
32052-05141 150 ug
EUR 428
Human RRAS2 AssayLite Antibody (RPE Conjugate)
32052-05151 150 ug
EUR 428
Human RRAS2 AssayLite Antibody (APC Conjugate)
32052-05161 150 ug
EUR 428
Human RRAS2 AssayLite Antibody (PerCP Conjugate)
32052-05171 150 ug
EUR 471
Rras2 ORF Vector (Rat) (pORF)
ORF075649 1.0 ug DNA
EUR 506
RRAS2 ORF Vector (Human) (pORF)
ORF009093 1.0 ug DNA
EUR 95
Rras2 ORF Vector (Mouse) (pORF)
ORF056454 1.0 ug DNA
EUR 506
RRAS2 ELISA Kit (Human) (OKEH08552)
OKEH08552 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.2pg/mL
RRAS2 ELISA Kit (Mouse) (OKEH08553)
OKEH08553 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10.2pg/mL
Monoclonal RRAS2 Antibody (monoclonal) (M01), Clone: 2D3-4B8
AMM04047G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human RRAS2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D3-4B8. This antibody is applicable in WB, IHC and IF, E
Rras2 sgRNA CRISPR Lentivector set (Rat)
K7303501 3 x 1.0 ug
EUR 339
Rras2 sgRNA CRISPR Lentivector set (Mouse)
K4611701 3 x 1.0 ug
EUR 339
RRAS2 sgRNA CRISPR Lentivector set (Human)
K2070601 3 x 1.0 ug
EUR 339
Human Ras-related protein R-Ras2 (RRAS2)
1-CSB-EP020514HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein R-Ras2(RRAS2) expressed in E.coli
Rras2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7303502 1.0 ug DNA
EUR 154
Rras2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7303503 1.0 ug DNA
EUR 154
Rras2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7303504 1.0 ug DNA
EUR 154
Rras2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4611702 1.0 ug DNA
EUR 154
Rras2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4611703 1.0 ug DNA
EUR 154
Rras2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4611704 1.0 ug DNA
EUR 154
RRAS2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2070602 1.0 ug DNA
EUR 154
RRAS2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2070603 1.0 ug DNA
EUR 154
RRAS2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2070604 1.0 ug DNA
EUR 154
RRAS2 Protein Vector (Rat) (pPB-C-His)
PV302594 500 ng
EUR 603
RRAS2 Protein Vector (Rat) (pPB-N-His)
PV302595 500 ng
EUR 603
RRAS2 Protein Vector (Rat) (pPM-C-HA)
PV302596 500 ng
EUR 603
RRAS2 Protein Vector (Rat) (pPM-C-His)
PV302597 500 ng
EUR 603
RRAS2 Protein Vector (Mouse) (pPB-C-His)
PV225814 500 ng
EUR 603
RRAS2 Protein Vector (Mouse) (pPB-N-His)
PV225815 500 ng
EUR 603
RRAS2 Protein Vector (Mouse) (pPM-C-HA)
PV225816 500 ng
EUR 603
RRAS2 Protein Vector (Mouse) (pPM-C-His)
PV225817 500 ng
EUR 603
RRAS2 Protein Vector (Human) (pPB-C-His)
PV036369 500 ng
EUR 329
RRAS2 Protein Vector (Human) (pPB-N-His)
PV036370 500 ng
EUR 329
RRAS2 Protein Vector (Human) (pPM-C-HA)
PV036371 500 ng
EUR 329
RRAS2 Protein Vector (Human) (pPM-C-His)
PV036372 500 ng
EUR 329
Rras2 3'UTR Luciferase Stable Cell Line
TU118189 1.0 ml Ask for price
Rras2 3'UTR GFP Stable Cell Line
TU168189 1.0 ml Ask for price
Rras2 3'UTR Luciferase Stable Cell Line
TU219731 1.0 ml Ask for price
Rras2 3'UTR GFP Stable Cell Line
TU269731 1.0 ml Ask for price
RRAS2 3'UTR GFP Stable Cell Line
TU072387 1.0 ml
EUR 1394
RRAS2 3'UTR Luciferase Stable Cell Line
TU022387 1.0 ml
EUR 1394
Related RAS Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
20-abx008268
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Related RAS Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
20-abx006887
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Related RAS Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
20-abx003379
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Related RAS Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
20-abx213490
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Related Ras Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
20-abx115122
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Related RAS Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
abx146436-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Related RAS Viral (R-Ras) Oncogene Homolog 2 (RRAS2) Antibody
abx237490-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RRAS2 Rabbit Polyclonal Antibody