October 23, 2021

PEX16 Rabbit Polyclonal Antibody

PEX16 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PEX16 Polyclonal Antibody

ABP59882-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PEX16 from Human, Mouse. This PEX16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX16 protein at amino acid sequence of 100-180

PEX16 Polyclonal Antibody

ES9980-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PEX16 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEX16 Polyclonal Antibody

ES9980-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PEX16 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEX16 Rabbit pAb

A10387-100ul 100 ul
EUR 308

PEX16 Rabbit pAb

A10387-200ul 200 ul
EUR 459

PEX16 Rabbit pAb

A10387-20ul 20 ul
EUR 183

PEX16 Rabbit pAb

A10387-50ul 50 ul
EUR 223

PEX16 Polyclonal Conjugated Antibody

C27412 100ul
EUR 397

PEX16 antibody

70R-19220 50 ul
EUR 435
Description: Rabbit polyclonal PEX16 antibody

PEX16 Antibody

1-CSB-PA897573ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PEX16. Recognizes PEX16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PEX16 Antibody

DF12168 200ul
EUR 304
Description: PEX16 antibody detects endogenous levels of PEX16.

PEX16 Antibody

1-CSB-PA017801GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PEX16. Recognizes PEX16 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- PEX16 antibody

FNab06328 100µg
EUR 505.25
  • Immunogen: peroxisomal biogenesis factor 16
  • Uniprot ID: Q9Y5Y5
  • Gene ID: 9409
  • Research Area: Signal Transduction
Description: Antibody raised against PEX16

Anti-PEX16 antibody

PAab06328 100 ug
EUR 355

Anti-PEX16 antibody

STJ112423 100 µl
EUR 277
Description: The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described.

Anti-PEX16 antibody

STJ191138 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PEX16

PEX16 siRNA

20-abx928280
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PEX16 siRNA

20-abx928281
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PEX16

PVT18255 2 ug
EUR 231

Mouse Peroxisomal membrane protein PEX16, Pex16 ELISA KIT

ELI-15239m 96 Tests
EUR 865

Bovine Peroxisomal membrane protein PEX16, PEX16 ELISA KIT

ELI-21954b 96 Tests
EUR 928

Human Peroxisomal membrane protein PEX16, PEX16 ELISA KIT

ELI-45034h 96 Tests
EUR 824

PEX16 cloning plasmid

CSB-CL897573HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1011
  • Sequence: atggagaagctgcggctcctgggcctccgctaccaggagtacgtgactcgtcacccggccgccacggcccagctggagacagcagtgcggggcttcagttacctgctggcaggtcgattcgccgattcgcacgagctgtcagagctggtgtactctgcctctaacctgcttgtgc
  • Show more
Description: A cloning plasmid for the PEX16 gene.

PEX16 Blocking Peptide

DF12168-BP 1mg
EUR 195

Anti-PEX16 (3E10)

YF-MA16820 200 ul
EUR 363
Description: Mouse monoclonal to PEX16

PEX16 ELISA KIT|Human

EF001690 96 Tests
EUR 689

Mouse PEX16 shRNA Plasmid

20-abx972003
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PEX16 shRNA Plasmid

20-abx956237
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PEX16 Recombinant Protein (Human)

RP023134 100 ug Ask for price

PEX16 Recombinant Protein (Mouse)

RP161387 100 ug Ask for price

PEX16 Recombinant Protein (Rat)

RP220088 100 ug Ask for price

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx114406
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx123682
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx126350
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

abx034247-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

abx034247-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

20-abx321341
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 16 (PEX16) Antibody

abx236328-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Pex16 ORF Vector (Rat) (pORF)

ORF073364 1.0 ug DNA
EUR 506

PEX16 ORF Vector (Human) (pORF)

ORF007712 1.0 ug DNA
EUR 95

Pex16 ORF Vector (Mouse) (pORF)

ORF053797 1.0 ug DNA
EUR 506

Pex16 sgRNA CRISPR Lentivector set (Rat)

K7135401 3 x 1.0 ug
EUR 339

Pex16 sgRNA CRISPR Lentivector set (Mouse)

K3261401 3 x 1.0 ug
EUR 339

PEX16 sgRNA CRISPR Lentivector set (Human)

K1629801 3 x 1.0 ug
EUR 339

Pex16 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7135402 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7135403 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7135404 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3261402 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3261403 1.0 ug DNA
EUR 154

Pex16 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3261404 1.0 ug DNA
EUR 154

PEX16 sgRNA CRISPR Lentivector (Human) (Target 1)

K1629802 1.0 ug DNA
EUR 154

PEX16 sgRNA CRISPR Lentivector (Human) (Target 2)

K1629803 1.0 ug DNA
EUR 154

PEX16 sgRNA CRISPR Lentivector (Human) (Target 3)

K1629804 1.0 ug DNA
EUR 154

PEX16 Protein Vector (Rat) (pPB-C-His)

PV293454 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPB-N-His)

PV293455 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPM-C-HA)

PV293456 500 ng
EUR 603

PEX16 Protein Vector (Rat) (pPM-C-His)

PV293457 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPB-C-His)

PV215186 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPB-N-His)

PV215187 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPM-C-HA)

PV215188 500 ng
EUR 603

PEX16 Protein Vector (Mouse) (pPM-C-His)

PV215189 500 ng
EUR 603

PEX16 Protein Vector (Human) (pPB-C-His)

PV030845 500 ng
EUR 329

PEX16 Protein Vector (Human) (pPB-N-His)

PV030846 500 ng
EUR 329

PEX16 Protein Vector (Human) (pPM-C-HA)

PV030847 500 ng
EUR 329

PEX16 Protein Vector (Human) (pPM-C-His)

PV030848 500 ng
EUR 329

Pex16 3'UTR Luciferase Stable Cell Line

TU116211 1.0 ml Ask for price

Pex16 3'UTR GFP Stable Cell Line

TU166211 1.0 ml Ask for price

Pex16 3'UTR Luciferase Stable Cell Line

TU216096 1.0 ml Ask for price

Pex16 3'UTR GFP Stable Cell Line

TU266096 1.0 ml Ask for price

PEX16 3'UTR GFP Stable Cell Line

TU067756 1.0 ml
EUR 1394

PEX16 3'UTR Luciferase Stable Cell Line

TU017756 1.0 ml
EUR 1394

Human Peroxisomal Biogenesis Factor 16 (PEX16) ELISA Kit

abx382161-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PEX16 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV627007 1.0 ug DNA
EUR 514

PEX16 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV627011 1.0 ug DNA
EUR 514

PEX16 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV627012 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

PEX16 Rabbit Polyclonal Antibody