SPAG5 Rabbit Polyclonal Antibody

SPAG5 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SPAG5 Polyclonal Antibody
ABP60485-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SPAG5 protein Applications tips:
Description: A polyclonal antibody for detection of SPAG5 from Human. This SPAG5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG5 protein

SPAG5 Polyclonal Antibody
ES10304-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SPAG5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SPAG5 Polyclonal Antibody
ES10304-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SPAG5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

SPAG5 Rabbit pAb
A6451-100ul	Abclonal	100 ul	EUR 308

SPAG5 Rabbit pAb
A6451-200ul	Abclonal	200 ul	EUR 459

SPAG5 Rabbit pAb
A6451-20ul	Abclonal	20 ul	EUR 183

SPAG5 Rabbit pAb
A6451-50ul	Abclonal	50 ul	EUR 223

SPAG5 antibody
70R-20473	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SPAG5 antibody

SPAG5 Antibody
35928-100ul	SAB	100ul	EUR 252

SPAG5 antibody
38929-100ul	SAB	100ul	EUR 252

SPAG5 Antibody
1-CSB-PA910765	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SPAG5 Antibody
1-CSB-PA853491ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SPAG5 Antibody
1-CSB-PA853491ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SPAG5 Antibody
DF9944	Affbiotech	200ul	EUR 304
Description: SPAG5 Antibody detects endogenous levels of total SPAG5.

SPAG5 Antibody
1-CSB-PA440250	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

SPAG5 Antibody
1-CSB-PA022466GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF, IP

SPAG5 Antibody
ABD9944	Lifescience Market	100 ug	EUR 438

SPAG5 Conjugated Antibody
C35928	SAB	100ul	EUR 397

anti- SPAG5 antibody
FNab08143	FN Test	100µg	EUR 585
Immunogen: sperm associated antigen 5 Uniprot ID: Q96R06 Gene ID: 10615 Research Area: Cell Division and Proliferation
Description: Antibody raised against SPAG5

Anti-SPAG5 antibody
PAab08143	Lifescience Market	100 ug	EUR 412

Anti-SPAG5 antibody
STJ116304	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles.

Anti-SPAG5 antibody
STJ191462	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SPAG5

Sperm associated antigen 5 (SPAG5) polyclonal antibody
ABP-PAB-10269	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

SPAG5 siRNA
20-abx934793	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SPAG5 siRNA
20-abx934794	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SPAG5 Blocking Peptide
DF9944-BP	Affbiotech	1mg	EUR 195

SPAG5 cloning plasmid
CSB-CL853491HU-10ug	Cusabio	10ug	EUR 1267
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3582 Sequence: atgtggcgagtgaaaaaactgagcctcagcctgtcgccttcgccccagacgggaaaaccatctatgagaactcctctccgtgaacttaccctgcagcccggtgccctcaccaactctggaaaaagatcccccgcttgctcctcgctgaccccatcactgtgcaagctggggctgc Show more
Description: A cloning plasmid for the SPAG5 gene.

pDONR223-SPAG5 Plasmid
PVTB00569	Lifescience Market	2 ug	EUR 356

Sperm Associated Antigen 5 (SPAG5) Antibody
20-abx004944	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
20-abx212669	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
20-abx212670	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
20-abx115760	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
abx122796-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
abx238143-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
20-abx320523	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Sperm Associated Antigen 5 (SPAG5) Antibody
20-abx321626	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

SPAG5 ELISA KIT|Human
EF007340	Lifescience Market	96 Tests	EUR 689

Mouse SPAG5 shRNA Plasmid
20-abx974427	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SPAG5 shRNA Plasmid
20-abx957228	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Monoclonal SPAG5 Antibody (monoclonal) (M01), Clone: 5F9
AMM04124G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human SPAG5 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 5F9. This antibody is applicable in WB

Spag5 ORF Vector (Rat) (pORF)
ORF076873	ABM	1.0 ug DNA	EUR 506

SPAG5 ORF Vector (Human) (pORF)
ORF009921	ABM	1.0 ug DNA	EUR 95

Spag5 ORF Vector (Mouse) (pORF)
ORF058240	ABM	1.0 ug DNA	EUR 506

SPAG5 ELISA Kit (Human) (OKWB00200)
OKWB00200	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: Essential component of the mitotic spindle required for normal chromosome segregation and progression into anaphase. Required for chromosome alignment, normal timing of sister chromatid segregation, and maintenance of spindle pole architecture. In complex with SKAP, promotes stable microtubule-kinetochore attachments. May contribute to the regulation of separase activity. May regulate AURKA localization to mitotic spindle, but not to centrosomes and CCNB1 localization to both mitotic spindle and centrosomes. Involved in centriole duplication. Required for CDK5RAP2, CEP152, WDR62 and CEP63 centrosomal localization and promotes the centrosomal localization of CDK2. In non-mitotic cells, upon stress induction, inhibits mammalian target of rapamycin complex 1 (mTORC1) association and recruits the mTORC1 component RPTOR to stress granules (SGs), thereby preventing mTORC1 hyperactivation-induced apoptosis. May enhance GSK3B-mediated phosphorylation of other substrates, such as MAPT/TAU.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Spag5 sgRNA CRISPR Lentivector set (Rat)
K7268801	ABM	3 x 1.0 ug	EUR 339

Spag5 sgRNA CRISPR Lentivector set (Mouse)
K4343101	ABM	3 x 1.0 ug	EUR 339

SPAG5 sgRNA CRISPR Lentivector set (Human)
K2264301	ABM	3 x 1.0 ug	EUR 339

SPAG5-AS1 ORF Vector (Human) (pORF)
ORF033214	ABM	1.0 ug DNA	Ask for price

Spag5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7268802	ABM	1.0 ug DNA	EUR 154

Spag5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7268803	ABM	1.0 ug DNA	EUR 154

Spag5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7268804	ABM	1.0 ug DNA	EUR 154

Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4343102	ABM	1.0 ug DNA	EUR 154

Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4343103	ABM	1.0 ug DNA	EUR 154

Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4343104	ABM	1.0 ug DNA	EUR 154

SPAG5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2264302	ABM	1.0 ug DNA	EUR 154

SPAG5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2264303	ABM	1.0 ug DNA	EUR 154

SPAG5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2264304	ABM	1.0 ug DNA	EUR 154

SPAG5 3'UTR Luciferase Stable Cell Line
TU024375	ABM	1.0 ml	EUR 1394

Spag5 3'UTR Luciferase Stable Cell Line
TU119519	ABM	1.0 ml	Ask for price

Spag5 3'UTR GFP Stable Cell Line
TU169519	ABM	1.0 ml	Ask for price

Spag5 3'UTR Luciferase Stable Cell Line
TU221020	ABM	1.0 ml	Ask for price

Spag5 3'UTR GFP Stable Cell Line
TU271020	ABM	1.0 ml	Ask for price

SPAG5 3'UTR GFP Stable Cell Line
TU074375	ABM	1.0 ml	EUR 1394

SPAG5 Protein Vector (Rat) (pPB-C-His)
PV307490	ABM	500 ng	EUR 1166

SPAG5 Protein Vector (Rat) (pPB-N-His)
PV307491	ABM	500 ng	EUR 1166

SPAG5 Protein Vector (Rat) (pPM-C-HA)
PV307492	ABM	500 ng	EUR 1166

SPAG5 Protein Vector (Rat) (pPM-C-His)
PV307493	ABM	500 ng	EUR 1166

SPAG5 Protein Vector (Human) (pPB-C-His)
PV039681	ABM	500 ng	EUR 329

SPAG5 Protein Vector (Human) (pPB-N-His)
PV039682	ABM	500 ng	EUR 329

SPAG5 Protein Vector (Human) (pPM-C-HA)
PV039683	ABM	500 ng	EUR 329

SPAG5 Protein Vector (Human) (pPM-C-His)
PV039684	ABM	500 ng	EUR 329

SPAG5 Protein Vector (Mouse) (pPB-C-His)
PV232958	ABM	500 ng	EUR 1065

SPAG5 Protein Vector (Mouse) (pPB-N-His)
PV232959	ABM	500 ng	EUR 1065

SPAG5 Protein Vector (Mouse) (pPM-C-HA)
PV232960	ABM	500 ng	EUR 1065

SPAG5 Protein Vector (Mouse) (pPM-C-His)
PV232961	ABM	500 ng	EUR 1065

Human Sperm Associated Antigen 5 (SPAG5) ELISA Kit
abx257271-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human SPAG5(sperm associated antigen 5) ELISA Kit
EH4134	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q96R06 Alias: Astrin/Deepest/Mitotic spindle-associated protein p126/MAP126
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Sperm- associated antigen 5, SPAG5 ELISA KIT
ELI-18254h	Lifescience Market	96 Tests	EUR 824

Mouse Sperm- associated antigen 5, Spag5 ELISA KIT
ELI-39527m	Lifescience Market	96 Tests	EUR 865

SPAG5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV631195	ABM	1.0 ug DNA	EUR 1355

SPAG5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV631199	ABM	1.0 ug DNA	EUR 1355

SPAG5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV631200	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

SPAG5 Rabbit Polyclonal Antibody