SPAG5 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 SPAG5 Polyclonal Antibody |
|
ABP60485-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SPAG5 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPAG5 from Human. This SPAG5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG5 protein |
SPAG5 Polyclonal Antibody |
|
ABP60485-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SPAG5 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPAG5 from Human. This SPAG5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG5 protein |
SPAG5 Polyclonal Antibody |
|
ABP60485-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SPAG5 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SPAG5 from Human. This SPAG5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPAG5 protein |
 SPAG5 Rabbit pAb |
|
A6451-100ul |
Abclonal |
100 ul |
EUR 308 |
SPAG5 Rabbit pAb |
|
A6451-200ul |
Abclonal |
200 ul |
EUR 459 |
SPAG5 Rabbit pAb |
|
A6451-20ul |
Abclonal |
20 ul |
EUR 183 |
SPAG5 Rabbit pAb |
|
A6451-50ul |
Abclonal |
50 ul |
EUR 223 |
 SPAG5 Antibody |
|
35928-100ul |
SAB |
100ul |
EUR 252 |
 SPAG5 antibody |
|
38929-100ul |
SAB |
100ul |
EUR 252 |
SPAG5 antibody |
|
70R-20473 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal SPAG5 antibody |
SPAG5 Antibody |
|
DF9944 |
Affbiotech |
200ul |
EUR 304 |
|
Description: SPAG5 Antibody detects endogenous levels of total SPAG5. |
SPAG5 Antibody |
|
1-CSB-PA910765 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
SPAG5 Antibody |
|
1-CSB-PA440250 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
SPAG5 Antibody |
|
1-CSB-PA853491ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
SPAG5 Antibody |
|
1-CSB-PA853491ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SPAG5 Antibody |
|
1-CSB-PA022466GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against SPAG5. Recognizes SPAG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF, IP |
 SPAG5 Conjugated Antibody |
|
C35928 |
SAB |
100ul |
EUR 397 |
 anti- SPAG5 antibody |
|
FNab08143 |
FN Test |
100µg |
EUR 585 |
- Immunogen: sperm associated antigen 5
- Uniprot ID: Q96R06
- Gene ID: 10615
- Research Area: Cell Division and Proliferation
|
|
Description: Antibody raised against SPAG5 |
 Anti-SPAG5 antibody |
|
STJ116304 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. |
Anti-SPAG5 antibody |
|
STJ191462 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SPAG5 |
 SPAG5 siRNA |
|
20-abx934793 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPAG5 siRNA |
|
20-abx934794 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) Sperm associated antigen 5 (SPAG5) polyclonal antibody |
|
ABP-PAB-10269 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
 SPAG5 cloning plasmid |
|
CSB-CL853491HU-10ug |
Cusabio |
10ug |
EUR 1267 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3582
- Sequence: atgtggcgagtgaaaaaactgagcctcagcctgtcgccttcgccccagacgggaaaaccatctatgagaactcctctccgtgaacttaccctgcagcccggtgccctcaccaactctggaaaaagatcccccgcttgctcctcgctgaccccatcactgtgcaagctggggctgc
- Show more
|
|
Description: A cloning plasmid for the SPAG5 gene. |
 SPAG5 Blocking Peptide |
|
DF9944-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse SPAG5 shRNA Plasmid |
|
20-abx974427 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SPAG5 shRNA Plasmid |
|
20-abx957228 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Sperm Associated Antigen 5 (SPAG5) Antibody |
|
20-abx115760 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
abx122796-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
20-abx004944 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
20-abx320523 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
20-abx321626 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
abx238143-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
20-abx212669 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sperm Associated Antigen 5 (SPAG5) Antibody |
|
20-abx212670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (M01), Clone: 5F9) Monoclonal SPAG5 Antibody (monoclonal) (M01), Clone: 5F9 |
|
AMM04124G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human SPAG5 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 5F9. This antibody is applicable in WB |
 (pORF)) Spag5 ORF Vector (Mouse) (pORF) |
|
ORF058240 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SPAG5 ORF Vector (Human) (pORF) |
|
ORF009921 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Spag5 ORF Vector (Rat) (pORF) |
|
ORF076873 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKWB00200)) SPAG5 ELISA Kit (Human) (OKWB00200) |
|
OKWB00200 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
|
Description: Description of target: Essential component of the mitotic spindle required for normal chromosome segregation and progression into anaphase. Required for chromosome alignment, normal timing of sister chromatid segregation, and maintenance of spindle pole architecture. In complex with SKAP, promotes stable microtubule-kinetochore attachments. May contribute to the regulation of separase activity. May regulate AURKA localization to mitotic spindle, but not to centrosomes and CCNB1 localization to both mitotic spindle and centrosomes. Involved in centriole duplication. Required for CDK5RAP2, CEP152, WDR62 and CEP63 centrosomal localization and promotes the centrosomal localization of CDK2. In non-mitotic cells, upon stress induction, inhibits mammalian target of rapamycin complex 1 (mTORC1) association and recruits the mTORC1 component RPTOR to stress granules (SGs), thereby preventing mTORC1 hyperactivation-induced apoptosis. May enhance GSK3B-mediated phosphorylation of other substrates, such as MAPT/TAU.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
) SPAG5 sgRNA CRISPR Lentivector set (Human) |
|
K2264301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Spag5 sgRNA CRISPR Lentivector set (Mouse) |
|
K4343101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Spag5 sgRNA CRISPR Lentivector set (Rat) |
|
K7268801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (pORF)) SPAG5-AS1 ORF Vector (Human) (pORF) |
|
ORF033214 |
ABM |
1.0 ug DNA |
Ask for price |
 (Target 1)) SPAG5 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2264302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SPAG5 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2264303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SPAG5 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2264304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4343102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4343103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Spag5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4343104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Spag5 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7268802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Spag5 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7268803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Spag5 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7268804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SPAG5 Protein Vector (Human) (pPB-C-His) |
|
PV039681 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SPAG5 Protein Vector (Human) (pPB-N-His) |
|
PV039682 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SPAG5 Protein Vector (Human) (pPM-C-HA) |
|
PV039683 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SPAG5 Protein Vector (Human) (pPM-C-His) |
|
PV039684 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SPAG5 Protein Vector (Rat) (pPB-C-His) |
|
PV307490 |
ABM |
500 ng |
EUR 1166 |
 (pPB-N-His)) SPAG5 Protein Vector (Rat) (pPB-N-His) |
|
PV307491 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-HA)) SPAG5 Protein Vector (Rat) (pPM-C-HA) |
|
PV307492 |
ABM |
500 ng |
EUR 1166 |
 (pPM-C-His)) SPAG5 Protein Vector (Rat) (pPM-C-His) |
|
PV307493 |
ABM |
500 ng |
EUR 1166 |
 (pPB-C-His)) SPAG5 Protein Vector (Mouse) (pPB-C-His) |
|
PV232958 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) SPAG5 Protein Vector (Mouse) (pPB-N-His) |
|
PV232959 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) SPAG5 Protein Vector (Mouse) (pPM-C-HA) |
|
PV232960 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) SPAG5 Protein Vector (Mouse) (pPM-C-His) |
|
PV232961 |
ABM |
500 ng |
EUR 1065 |
 Spag5 3'UTR GFP Stable Cell Line |
|
TU169519 |
ABM |
1.0 ml |
Ask for price |
 Spag5 3'UTR Luciferase Stable Cell Line |
|
TU119519 |
ABM |
1.0 ml |
Ask for price |
 SPAG5 3'UTR GFP Stable Cell Line |
|
TU074375 |
ABM |
1.0 ml |
EUR 1394 |
 SPAG5 3'UTR Luciferase Stable Cell Line |
|
TU024375 |
ABM |
1.0 ml |
EUR 1394 |
Spag5 3'UTR Luciferase Stable Cell Line |
|
TU221020 |
ABM |
1.0 ml |
Ask for price |
Spag5 3'UTR GFP Stable Cell Line |
|
TU271020 |
ABM |
1.0 ml |
Ask for price |
 ELISA Kit) Human SPAG5(sperm associated antigen 5) ELISA Kit |
|
EH4134 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q96R06
- Alias: Astrin/Deepest/Mitotic spindle-associated protein p126/MAP126
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
 Human Sperm- associated antigen 5, SPAG5 ELISA KIT |
|
ELI-18254h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Sperm- associated antigen 5, Spag5 ELISA KIT |
|
ELI-39527m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Human Sperm Associated Antigen 5 (SPAG5) ELISA Kit |
|
abx257271-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) SPAG5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV631195 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) SPAG5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV631199 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) SPAG5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV631200 |
ABM |
1.0 ug DNA |
EUR 1355 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SPAG5 Rabbit Polyclonal Antibody
