NLGN3 Rabbit Polyclonal Antibody

NLGN3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NLGN3 Polyclonal Antibody
ABP59479-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690 Applications tips:
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690

NLGN3 Polyclonal Antibody
ABP59479-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690 Applications tips:
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690

NLGN3 Polyclonal Antibody
ABP59479-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690 Applications tips:
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690

NLGN3 Rabbit pAb
A10310-100ul	Abclonal	100 ul	EUR 308

NLGN3 Rabbit pAb
A10310-200ul	Abclonal	200 ul	EUR 459

NLGN3 Rabbit pAb
A10310-20ul	Abclonal	20 ul	EUR 183

NLGN3 Rabbit pAb
A10310-50ul	Abclonal	50 ul	EUR 223

NLGN3 Antibody
ABD9692	Lifescience Market	100 ug	EUR 438

NLGN3 Antibody
46087-100ul	SAB	100ul	EUR 252

NLGN3 Antibody
46087-50ul	SAB	50ul	EUR 187

NLGN3 Antibody
DF9692	Affbiotech	200ul	EUR 304
Description: NLGN3 Antibody detects endogenous levels of total NLGN3.

NLGN3 Antibody
1-CSB-PA873703LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

Polyclonal Nlgn3 Antibody - N-terminal region
AMM06712G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nlgn3 - N-terminal region. This antibody is tested and proven to work in the following applications:

NLGN3 Conjugated Antibody
C46087	SAB	100ul	EUR 397

Anti-NLGN3 antibody
STJ112348	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene.

Anti-NLGN3 antibody
STJ191071	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NLGN3

NLGN3 siRNA
20-abx903573	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NLGN3 siRNA
20-abx925998	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NLGN3 siRNA
20-abx925999	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody
20-abx126255	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Neuroligin 3 (Nlgn3) Antibody
20-abx121179	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody
20-abx217192	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody
20-abx333727	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuroligin 3 (Nlgn3) Antibody
abx433027-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Neuroligin 3 (Nlgn3) Antibody
abx445080-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

NLGN3 Antibody, HRP conjugated
1-CSB-PA873703LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLGN3 Antibody, FITC conjugated
1-CSB-PA873703LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLGN3 Antibody, Biotin conjugated
1-CSB-PA873703LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NLGN3 cloning plasmid
CSB-CL873703HU-10ug	Cusabio	10ug	EUR 805
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2487 Sequence: atgtggctgcggcttggcccgccctcgctgtccctgagccccaagcccacggttggcaggagcctgtgcctcaccctgtggttcctcagtttggcgctgagggccagtacccaggccccagcacccacagtcaacactcactttgggaagctaaggggtgcccgagtaccactgc Show more
Description: A cloning plasmid for the NLGN3 gene.

NLGN3 Blocking Peptide
DF9692-BP	Affbiotech	1mg	EUR 195

Neuroligin-3 (NLGN3) Antibody (HRP)
20-abx336763	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody (FITC)
20-abx336764	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuroligin-3 (NLGN3) Antibody (Biotin)
20-abx336765	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neuroligin 3 (Nlgn3) Antibody (ALP)
abx442477-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (APC)
abx442758-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (Biotin)
abx443038-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (FITC)
abx443318-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (HRP)
abx443599-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (PerCP)
abx444161-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (RPE)
abx444442-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Neuroligin 3 (Nlgn3) Antibody (Streptavidin)
abx444723-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Rat NLGN3 shRNA Plasmid
20-abx987731	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NLGN3 shRNA Plasmid
20-abx982762	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NLGN3 Rabbit Polyclonal Antibody