October 23, 2021

STK25 Rabbit Polyclonal Antibody

STK25 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STK25 Polyclonal Antibody
31735-50ul 50ul
EUR 187
STK25 Polyclonal Antibody
A54396 100 µg
EUR 570.55
Description: The best epigenetics products
STK25 Polyclonal Antibody
ABP60540-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
STK25 Polyclonal Antibody
ABP60540-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
STK25 Polyclonal Antibody
ABP60540-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
STK25 Polyclonal Antibody
ES10200-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STK25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
STK25 Polyclonal Antibody
ES10200-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
STK25 Rabbit pAb
A9726-100ul 100 ul
EUR 308
STK25 Rabbit pAb
A9726-200ul 200 ul
EUR 459
STK25 Rabbit pAb
A9726-20ul 20 ul
EUR 183
STK25 Rabbit pAb
A9726-50ul 50 ul
EUR 223
STK25 Polyclonal Conjugated Antibody
C31735 100ul
EUR 397
STK25 antibody
22448-100ul 100ul
EUR 390
STK25 antibody
70R-13091 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STK25 antibody
STK25 Antibody
DF9883 200ul
EUR 304
Description: STK25 Antibody detects endogenous levels of total STK25.
Stk25 antibody
70R-8797 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Stk25 antibody
STK25 Antibody
1-CSB-PA022842LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STK25 Antibody
ABD9883 100 ug
EUR 438
Polyclonal STK25 Antibody (C-term)
APR10930G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK25 (C-term). This antibody is tested and proven to work in the following applications:
STK25 Polyclonal Antibody, Biotin Conjugated
A54393 100 µg
EUR 570.55
Description: Ask the seller for details
STK25 Polyclonal Antibody, FITC Conjugated
A54394 100 µg
EUR 570.55
Description: The best epigenetics products
STK25 Polyclonal Antibody, HRP Conjugated
A54395 100 µg
EUR 570.55
Description: kits suitable for this type of research
Mouse Stk25 Antibody
abx028074-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Mouse Stk25 Antibody
abx028074-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
anti- STK25 antibody
FNab08328 100µg
EUR 585
  • Immunogen: serine/threonine kinase 25(STE20 homolog, yeast)
  • Uniprot ID: O00506
  • Gene ID: 10494
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK25
Anti-STK25 antibody
PAab08328 100 ug
EUR 412
Anti-STK25 antibody
STJ111804 100 µl
EUR 277
Description: This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene.
Anti-STK25 antibody
STJ191358 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK25
STK25 siRNA
20-abx935467
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STK25 siRNA
20-abx935468
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-STK25
YF-PA17007 50 ul
EUR 363
Description: Mouse polyclonal to STK25
anti-STK25
YF-PA17008 100 ug
EUR 403
Description: Rabbit polyclonal to STK25
STK25 Antibody, HRP conjugated
1-CSB-PA022842LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
STK25 Antibody, FITC conjugated
1-CSB-PA022842LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
STK25 Antibody, Biotin conjugated
1-CSB-PA022842LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Stk25 Blocking Peptide
33R-9142 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stk25 antibody, catalog no. 70R-8797
STK25 Blocking Peptide
DF9883-BP 1mg
EUR 195
STK25 cloning plasmid
CSB-CL022842HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg
  • Show more
Description: A cloning plasmid for the STK25 gene.
STK25 cloning plasmid
CSB-CL022842HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1281
  • Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg
  • Show more
Description: A cloning plasmid for the STK25 gene.
anti-STK25 (1G6)
LF-MA10320 100 ug
EUR 363
Description: Mouse monoclonal to STK25
Anti-STK25 (4B10)
YF-MA17339 100 ug
EUR 363
Description: Mouse monoclonal to STK25
STK25 ELISA KIT|Human
EF003307 96 Tests
EUR 689
Mouse STK25 shRNA Plasmid
20-abx975164
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human STK25 shRNA Plasmid
20-abx957131
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STK25 Recombinant Protein (Rat)
RP231458 100 ug Ask for price
pCMV-SPORT6.1-STK25 Plasmid
PVT16016 2 ug
EUR 325
STK25 Recombinant Protein (Human)
RP030412 100 ug Ask for price
STK25 Recombinant Protein (Human)
RP030415 100 ug Ask for price
STK25 Recombinant Protein (Mouse)
RP176060 100 ug Ask for price
Serine/Threonine Kinase 25 (STK25) Antibody
20-abx123789
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Serine/Threonine Kinase 25 (STK25) Antibody
abx145678-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Serine/Threonine Kinase 25 (STK25) Antibody
abx034689-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Serine/Threonine Kinase 25 (STK25) Antibody
abx034689-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Serine/Threonine Kinase 25 (STK25) Antibody
abx238328-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Serine/threonine-Protein Kinase 25 (STK25) Antibody
20-abx110200
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase 25 (STK25) Antibody
abx033788-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Serine/Threonine-Protein Kinase 25 (STK25) Antibody
abx033788-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Stk25 ORF Vector (Rat) (pORF)
ORF077154 1.0 ug DNA
EUR 506
h STK25 inducible lentiviral particles
LVP246 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK25, is fully sequence verified and matched to NCBI accession ID: NM_006374
STK25 ORF Vector (Human) (pORF)
ORF010138 1.0 ug DNA
EUR 95
STK25 ORF Vector (Human) (pORF)
ORF010139 1.0 ug DNA
EUR 95
Stk25 ORF Vector (Mouse) (pORF)
ORF058688 1.0 ug DNA
EUR 506
Stk25 sgRNA CRISPR Lentivector set (Rat)
K7599901 3 x 1.0 ug
EUR 339
Stk25 sgRNA CRISPR Lentivector set (Mouse)
K3817601 3 x 1.0 ug
EUR 339
STK25 sgRNA CRISPR Lentivector set (Human)
K2303701 3 x 1.0 ug
EUR 339
Human Serine/threonine-protein kinase 25 (STK25)
1-CSB-EP022842HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 64.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Serine/threonine-protein kinase 25(STK25) expressed in E.coli
Stk25 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7599902 1.0 ug DNA
EUR 154
Stk25 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7599903 1.0 ug DNA
EUR 154
Stk25 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7599904 1.0 ug DNA
EUR 154
Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3817602 1.0 ug DNA
EUR 154
Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3817603 1.0 ug DNA
EUR 154
Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3817604 1.0 ug DNA
EUR 154
STK25 sgRNA CRISPR Lentivector (Human) (Target 1)
K2303702 1.0 ug DNA
EUR 154
STK25 sgRNA CRISPR Lentivector (Human) (Target 2)
K2303703 1.0 ug DNA
EUR 154
STK25 sgRNA CRISPR Lentivector (Human) (Target 3)
K2303704 1.0 ug DNA
EUR 154
STK25 Protein Vector (Rat) (pPB-C-His)
PV308614 500 ng
EUR 603
STK25 Protein Vector (Rat) (pPB-N-His)
PV308615 500 ng
EUR 603
STK25 Protein Vector (Rat) (pPM-C-HA)
PV308616 500 ng
EUR 603
STK25 Protein Vector (Rat) (pPM-C-His)
PV308617 500 ng
EUR 603
STK25 Protein Vector (Human) (pPB-C-His)
PV040549 500 ng
EUR 329
STK25 Protein Vector (Human) (pPB-N-His)
PV040550 500 ng
EUR 329
STK25 Protein Vector (Human) (pPM-C-HA)
PV040551 500 ng
EUR 329
STK25 Protein Vector (Human) (pPM-C-His)
PV040552 500 ng
EUR 329
STK25 Protein Vector (Human) (pPB-C-His)
PV040553 500 ng
EUR 329
STK25 Protein Vector (Human) (pPB-N-His)
PV040554 500 ng
EUR 329
STK25 Protein Vector (Human) (pPM-C-HA)
PV040555 500 ng
EUR 329
STK25 Protein Vector (Human) (pPM-C-His)
PV040556 500 ng
EUR 329
STK25 Protein Vector (Mouse) (pPB-C-His)
PV234750 500 ng
EUR 603
STK25 Protein Vector (Mouse) (pPB-N-His)
PV234751 500 ng
EUR 603
STK25 Protein Vector (Mouse) (pPM-C-HA)
PV234752 500 ng
EUR 603
STK25 Protein Vector (Mouse) (pPM-C-His)
PV234753 500 ng
EUR 603
Stk25 3'UTR Luciferase Stable Cell Line
TU119846 1.0 ml Ask for price
Stk25 3'UTR GFP Stable Cell Line
TU169846 1.0 ml Ask for price
Stk25 3'UTR Luciferase Stable Cell Line
TU221313 1.0 ml Ask for price
STK25 3'UTR GFP Stable Cell Line
TU074820 1.0 ml
EUR 1521
Stk25 3'UTR GFP Stable Cell Line
TU271313 1.0 ml Ask for price
STK25 3'UTR Luciferase Stable Cell Line
TU024820 1.0 ml
EUR 1521
Human Serine/Threonine Kinase 25 (STK25) ELISA Kit
abx383521-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
STK25 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715515 1.0 ug DNA
EUR 316
STK25 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715519 1.0 ug DNA
EUR 316
STK25 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715520 1.0 ug DNA
EUR 316
STK25 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV639979 1.0 ug DNA
EUR 682
STK25 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV639983 1.0 ug DNA
EUR 682
STK25 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV639984 1.0 ug DNA
EUR 682
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

STK25 Rabbit Polyclonal Antibody