RGS20 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 RGS20 Polyclonal Antibody |
|
ES10148-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RGS20 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 RGS20 Rabbit pAb |
|
A8167-100ul |
Abclonal |
100 ul |
EUR 308 |
RGS20 Rabbit pAb |
|
A8167-200ul |
Abclonal |
200 ul |
EUR 459 |
RGS20 Rabbit pAb |
|
A8167-20ul |
Abclonal |
20 ul |
EUR 183 |
RGS20 Rabbit pAb |
|
A8167-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal RGS20 Antibody (Center) |
|
AMM07590G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 (Center). This antibody is tested and proven to work in the following applications: |
 RGS20 antibody |
|
70R-1129 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal RGS20 antibody raised against the N terminal of RGS20 |
RGS20 antibody |
|
70R-1143 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal RGS20 antibody raised against the middle region of RGS20 |
RGS20 antibody |
|
70R-19875 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RGS20 antibody |
 RGS20 Antibody |
|
46197-100ul |
SAB |
100ul |
EUR 252 |
RGS20 Antibody |
|
46197-50ul |
SAB |
50ul |
EUR 187 |
RGS20 Antibody |
|
DF9846 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RGS20 Antibody detects endogenous levels of total RGS20. |
RGS20 antibody |
|
70R-51346 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RGS20 antibody |
RGS20 Antibody |
|
1-CSB-PA019652ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200 |
RGS20 Antibody |
|
1-CSB-PA019652GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against RGS20. Recognizes RGS20 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 Polyclonal RGS20 antibody - N-terminal region |
|
AMM07592G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS20 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 RGS20 Conjugated Antibody |
|
C46197 |
SAB |
100ul |
EUR 397 |
 Anti-RGS20 antibody |
|
STJ110466 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-RGS20 antibody |
|
STJ191306 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RGS20 |
 RGS20 siRNA |
|
20-abx931406 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS20 siRNA |
|
20-abx931407 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RGS20 |
|
YF-PA15737 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA15738 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA15739 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA15740 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to RGS20 |
anti-RGS20 |
|
YF-PA25140 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to RGS20 |
 RGS20 Blocking Peptide |
|
33R-4413 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1129 |
RGS20 Blocking Peptide |
|
33R-6636 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS20 antibody, catalog no. 70R-1143 |
RGS20 Blocking Peptide |
|
DF9846-BP |
Affbiotech |
1mg |
EUR 195 |
RGS20 Blocking Peptide |
|
20-abx064221 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 RGS20 cloning plasmid |
|
CSB-CL019652HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaacgcatgctgcttctgctggtgctgctgttgtagctgctcgtgtctcactgttagaaaccaggaagatcagag
- Show more
|
|
Description: A cloning plasmid for the RGS20 gene. |
RGS20 cloning plasmid |
|
CSB-CL019652HU2-10ug |
Cusabio |
10ug |
EUR 313 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 726
- Sequence: atgcgcacggcggacggaggcgagccggccggggcttcctccccggccggcagggtggacggtgggctccagatgggatcagagcggatggagatgcggaagcggcagatgcccgccgcccaggacacaccaggcgccgccccaggccagcccggagcggggagtcgcgggtccaa
- Show more
|
|
Description: A cloning plasmid for the RGS20 gene. |
) Anti-RGS20 (3E10) |
|
YF-MA16449 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RGS20 |
 Mouse RGS20 shRNA Plasmid |
|
20-abx975058 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RGS20 shRNA Plasmid |
|
20-abx955649 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RGS20 Recombinant Protein (Human) |
|
RP026317 |
ABM |
100 ug |
Ask for price |
RGS20 Recombinant Protein (Human) |
|
RP026320 |
ABM |
100 ug |
Ask for price |
) RGS20 Recombinant Protein (Mouse) |
|
RP167897 |
ABM |
100 ug |
Ask for price |
RGS20 Recombinant Protein (Mouse) |
|
RP167900 |
ABM |
100 ug |
Ask for price |
) RGS20 Recombinant Protein (Rat) |
|
RP225953 |
ABM |
100 ug |
Ask for price |
 (M04), Clone: 3E11) Monoclonal RGS20 Antibody (monoclonal) (M04), Clone: 3E11 |
|
AMM07591G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human RGS20 (monoclonal) (M04). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E |
 (pORF)) Rgs20 ORF Vector (Rat) (pORF) |
|
ORF075319 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) RGS20 ORF Vector (Human) (pORF) |
|
ORF008773 |
ABM |
1.0 ug DNA |
EUR 95 |
RGS20 ORF Vector (Human) (pORF) |
|
ORF008774 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Rgs20 ORF Vector (Mouse) (pORF) |
|
ORF055967 |
ABM |
1.0 ug DNA |
EUR 506 |
Rgs20 ORF Vector (Mouse) (pORF) |
|
ORF055968 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA kit) Rabbit Regulator of G protein signaling 20(RGS20) ELISA kit |
|
E04R0409-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 20(RGS20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Regulator of G protein signaling 20(RGS20) ELISA kit |
|
E04R0409-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 20(RGS20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Regulator of G protein signaling 20(RGS20) ELISA kit |
|
E04R0409-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Regulator of G protein signaling 20(RGS20) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Regulator of G-Protein Signaling 20 (RGS20) Antibody |
|
20-abx007809 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Regulator of G-Protein Signaling 20 (RGS20) Antibody |
|
20-abx005714 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Regulator of G-Protein Signaling 20 (RGS20) Antibody |
|
20-abx218277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Regulator of G-Protein Signaling 20 (RGS20) Antibody |
|
20-abx115112 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Regulator of G-Protein Signaling 20 (RGS20) Antibody |
|
20-abx322177 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Rgs20 sgRNA CRISPR Lentivector set (Rat) |
|
K6376601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) RGS20 sgRNA CRISPR Lentivector set (Human) |
|
K1818601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rgs20 sgRNA CRISPR Lentivector set (Mouse) |
|
K3949901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Rgs20 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6376602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rgs20 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6376603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rgs20 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6376604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) RGS20 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1818602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RGS20 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1818603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RGS20 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1818604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rgs20 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3949902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rgs20 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3949903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rgs20 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3949904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RGS20 Protein Vector (Rat) (pPB-C-His) |
|
PV301274 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RGS20 Protein Vector (Rat) (pPB-N-His) |
|
PV301275 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RGS20 Protein Vector (Rat) (pPM-C-HA) |
|
PV301276 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RGS20 Protein Vector (Rat) (pPM-C-His) |
|
PV301277 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) RGS20 Protein Vector (Human) (pPB-C-His) |
|
PV035089 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) RGS20 Protein Vector (Human) (pPB-N-His) |
|
PV035090 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) RGS20 Protein Vector (Human) (pPM-C-HA) |
|
PV035091 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) RGS20 Protein Vector (Human) (pPM-C-His) |
|
PV035092 |
ABM |
500 ng |
EUR 329 |
RGS20 Protein Vector (Human) (pPB-C-His) |
|
PV035093 |
ABM |
500 ng |
EUR 329 |
RGS20 Protein Vector (Human) (pPB-N-His) |
|
PV035094 |
ABM |
500 ng |
EUR 329 |
RGS20 Protein Vector (Human) (pPM-C-HA) |
|
PV035095 |
ABM |
500 ng |
EUR 329 |
RGS20 Protein Vector (Human) (pPM-C-His) |
|
PV035096 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) RGS20 Protein Vector (Mouse) (pPB-C-His) |
|
PV223866 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RGS20 Protein Vector (Mouse) (pPB-N-His) |
|
PV223867 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RGS20 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223868 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RGS20 Protein Vector (Mouse) (pPM-C-His) |
|
PV223869 |
ABM |
500 ng |
EUR 603 |
RGS20 Protein Vector (Mouse) (pPB-C-His) |
|
PV223870 |
ABM |
500 ng |
EUR 603 |
RGS20 Protein Vector (Mouse) (pPB-N-His) |
|
PV223871 |
ABM |
500 ng |
EUR 603 |
RGS20 Protein Vector (Mouse) (pPM-C-HA) |
|
PV223872 |
ABM |
500 ng |
EUR 603 |
RGS20 Protein Vector (Mouse) (pPM-C-His) |
|
PV223873 |
ABM |
500 ng |
EUR 603 |
 Rgs20 3'UTR Luciferase Stable Cell Line |
|
TU117799 |
ABM |
1.0 ml |
Ask for price |
 Rgs20 3'UTR GFP Stable Cell Line |
|
TU167799 |
ABM |
1.0 ml |
Ask for price |
Rgs20 3'UTR Luciferase Stable Cell Line |
|
TU219376 |
ABM |
1.0 ml |
Ask for price |
Rgs20 3'UTR GFP Stable Cell Line |
|
TU269376 |
ABM |
1.0 ml |
Ask for price |
 RGS20 3'UTR GFP Stable Cell Line |
|
TU069856 |
ABM |
1.0 ml |
EUR 1394 |
 RGS20 3'UTR Luciferase Stable Cell Line |
|
TU019856 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
RGS20 Rabbit Polyclonal Antibody
