October 23, 2021

RAC3 Rabbit Polyclonal Antibody

RAC3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAC3 Polyclonal Antibody

ES10109-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAC3 Rabbit pAb

A7498-100ul 100 ul
EUR 308

RAC3 Rabbit pAb

A7498-200ul 200 ul
EUR 459

RAC3 Rabbit pAb

A7498-20ul 20 ul
EUR 183

RAC3 Rabbit pAb

A7498-50ul 50 ul
EUR 223

RAC3 antibody

70R-19740 50 ul
EUR 435
Description: Rabbit polyclonal RAC3 antibody

RAC3 Antibody

47716-100ul 100ul
EUR 252

RAC3 Antibody

1-CSB-PA019249ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAC3. Recognizes RAC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAC3 Antibody

1-CSB-PA019249GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAC3. Recognizes RAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

RAC3 Conjugated Antibody

C47716 100ul
EUR 397

Anti-RAC3 antibody

STJ29634 100 µl
EUR 277
Description: The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Alternative splicing results in multiple transcript variants.

Anti-RAC3 antibody

STJ191267 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAC3

RAC3 protein

30R-1843 100 ug
EUR 305
Description: Purified recombinant Human RAC3 protein

RAC3 siRNA

20-abx930751
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAC3 siRNA

20-abx930752
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAC3

YF-PA14266 100 ug
EUR 403
Description: Rabbit polyclonal to RAC3

Rabbit Anti-RAC3 monoclonal antibody, clone KN22-30

CABT-L943 100 ul
EUR 777

RAC3 cloning plasmid

CSB-CL019249HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 579
  • Sequence: atgcaggccatcaagtgcgtggtggtcggcgacggcgccgtggggaagacatgcttgctgatcagctacacgaccaacgccttccccggagagtacatccccaccgtttttgacaactactctgccaacgtgatggtggacgggaaaccagtcaacttggggctgtgggacacagc
  • Show more
Description: A cloning plasmid for the RAC3 gene.

RAC1/RAC2/RAC3/CDC42 Antibody

1-CSB-PA003908
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAC1/RAC2/RAC3/CDC42. Recognizes RAC1/RAC2/RAC3/CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

RAC1 / RAC2 / RAC3 / CDC42 Antibody

20-abx328546
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Rac3 ELISA KIT

ELI-14920m 96 Tests
EUR 865

Human RAC3 ELISA KIT

ELI-52488h 96 Tests
EUR 824

Human RAC3 shRNA Plasmid

20-abx953971
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAC3 shRNA Plasmid

20-abx980334
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAC3 Recombinant Protein (Human)

RP025612 100 ug Ask for price

RAC3 Recombinant Protein (Mouse)

RP166448 100 ug Ask for price

RAC3 ORF Vector (Human) (pORF)

ORF008538 1.0 ug DNA
EUR 95

Rac3 ORF Vector (Mouse) (pORF)

ORF055484 1.0 ug DNA
EUR 506

RAC3 sgRNA CRISPR Lentivector set (Human)

K1777601 3 x 1.0 ug
EUR 339

Rac3 sgRNA CRISPR Lentivector set (Mouse)

K3861301 3 x 1.0 ug
EUR 339

Ras-Related C3 Botulinum Toxin Substrate 3 (RAC3) Antibody

20-abx006995
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related C3 Botulinum Toxin Substrate 3 (RAC3) Antibody

20-abx115075
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related C3 Botulinum Toxin Substrate 3 (RAC3) Antibody

20-abx320974
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1777602 1.0 ug DNA
EUR 154

RAC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1777603 1.0 ug DNA
EUR 154

RAC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1777604 1.0 ug DNA
EUR 154

Rac3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3861302 1.0 ug DNA
EUR 154

Rac3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3861303 1.0 ug DNA
EUR 154

Rac3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3861304 1.0 ug DNA
EUR 154

RAC3 Protein Vector (Human) (pPB-C-His)

PV034149 500 ng
EUR 329

RAC3 Protein Vector (Human) (pPB-N-His)

PV034150 500 ng
EUR 329

RAC3 Protein Vector (Human) (pPM-C-HA)

PV034151 500 ng
EUR 329

RAC3 Protein Vector (Human) (pPM-C-His)

PV034152 500 ng
EUR 329

RAC3 Protein Vector (Mouse) (pPB-C-His)

PV221934 500 ng
EUR 603

RAC3 Protein Vector (Mouse) (pPB-N-His)

PV221935 500 ng
EUR 603

RAC3 Protein Vector (Mouse) (pPM-C-HA)

PV221936 500 ng
EUR 603

RAC3 Protein Vector (Mouse) (pPM-C-His)

PV221937 500 ng
EUR 603

Rac3 3'UTR Luciferase Stable Cell Line

TU117462 1.0 ml Ask for price

Rac3 3'UTR GFP Stable Cell Line

TU167462 1.0 ml Ask for price

RAC3 3'UTR GFP Stable Cell Line

TU069426 1.0 ml
EUR 1394

RAC3 3'UTR Luciferase Stable Cell Line

TU019426 1.0 ml
EUR 1394

Human Ras-related C3 botulinum toxin substrate 3 (RAC3)

1-CSB-EP019249HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 48 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related C3 botulinum toxin substrate 3(RAC3) expressed in E.coli

Ras-Related C3 Botulinum Toxin Substrate 3 (RAC3) Protein

20-abx260838
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

RAC3 Rabbit Polyclonal Antibody