October 26, 2021

PPME1 Rabbit Polyclonal Antibody

PPME1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PPME1 Polyclonal Antibody

ABP59987-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300
  • Applications tips:
Description: A polyclonal antibody for detection of PPME1 from Human, Mouse, Rat. This PPME1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PPME1 protein at amino acid sequence of 220-300

PPME1 Polyclonal Antibody

A50424 100 µg
EUR 570.55
Description: Ask the seller for details

PPME1 Polyclonal Antibody

27895-100ul 100ul
EUR 252

PPME1 Polyclonal Antibody

27895-50ul 50ul
EUR 187

PPME1 Rabbit pAb

A13094-100ul 100 ul
EUR 308

PPME1 Rabbit pAb

A13094-200ul 200 ul
EUR 459

PPME1 Rabbit pAb

A13094-20ul 20 ul
EUR 183

PPME1 Rabbit pAb

A13094-50ul 50 ul
EUR 223

PPME1 Polyclonal Conjugated Antibody

C27895 100ul
EUR 397

PPME1 antibody

70R-3708 50 ug
EUR 467
Description: Rabbit polyclonal PPME1 antibody raised against the N terminal of PPME1

PPME1 antibody

70R-3709 50 ug
EUR 467
Description: Rabbit polyclonal PPME1 antibody raised against the N terminal of PPME1

PPME1 antibody

10R-5387 100 ul
EUR 691
Description: Mouse monoclonal PPME1 antibody

PPME1 antibody

10R-5388 100 ul
EUR 691
Description: Mouse monoclonal PPME1 antibody

PPME1 antibody

10R-5389 100 ul
EUR 691
Description: Mouse monoclonal PPME1 antibody

PPME1 antibody

70R-19465 50 ul
EUR 435
Description: Rabbit polyclonal PPME1 antibody

PPME1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PPME1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

Polyclonal PPME1 Antibody (C-term)

AMM07292G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPME1 (C-term). This antibody is tested and proven to work in the following applications:

PPME1 Polyclonal Antibody, HRP Conjugated

A50425 100 µg
EUR 570.55
Description: The best epigenetics products

PPME1 Polyclonal Antibody, FITC Conjugated

A50426 100 µg
EUR 570.55
Description: kits suitable for this type of research

PPME1 Polyclonal Antibody, Biotin Conjugated

A50427 100 µg
EUR 570.55
Description: fast delivery possible

anti- PPME1 antibody

FNab06692 100µg
EUR 548.75
  • Immunogen: protein phosphatase methylesterase 1
  • Uniprot ID: Q9Y570
  • Gene ID: 51400
  • Research Area: Metabolism
Description: Antibody raised against PPME1

Human PPME1 Antibody

32213-05111 150 ug
EUR 261

Anti-PPME1 antibody

PAab06692 100 ug
EUR 386

Anti-PPME1 antibody

STJ115061 100 µl
EUR 277
Description: This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants.

Anti-PPME1 antibody

STJ191219 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PPME1

Ppme1/ Rat Ppme1 ELISA Kit

ELI-45447r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19030 50 ul
EUR 363
Description: Mouse polyclonal to PPME1


YF-PA19031 50 ug
EUR 363
Description: Mouse polyclonal to PPME1

PPME1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PPME1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PPME1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPME1. Recognizes PPME1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PPME1 cloning plasmid

CSB-CL018501HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1161
  • Sequence: atgtcggccctcgaaaagagcatgcacctcggccgccttccctctcgcccacctctacccggcagcgggggcagtcagagcggagccaagatgcgaatgggccctggaagaaagcgggacttttcccctgttccttggagtcagtattttgagtccatggaagatgtagaagtag
  • Show more
Description: A cloning plasmid for the PPME1 gene.

PPME1 Protein (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

PPME1 Blocking Peptide

33R-6394 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPME1 antibody, catalog no. 70R-3708

PPME1 Blocking Peptide

33R-7126 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PPME1 antibody, catalog no. 70R-3709

pENTR223-PPME1 vector

PVT12037 2 ug
EUR 308

Human PPME1 Antibody (Biotin Conjugate)

32213-05121 150 ug
EUR 369

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

abx048500-100ug 100 ug
EUR 481
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

  • EUR 98.00
  • EUR 133.00
  • EUR 523.00
  • 10 ul
  • 20 ul
  • 400 ul
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

abx029420-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody

abx236692-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human PPME1 AssayLite Antibody (FITC Conjugate)

32213-05141 150 ug
EUR 428

Human PPME1 AssayLite Antibody (RPE Conjugate)

32213-05151 150 ug
EUR 428

Human PPME1 AssayLite Antibody (APC Conjugate)

32213-05161 150 ug
EUR 428

Human PPME1 AssayLite Antibody (PerCP Conjugate)

32213-05171 150 ug
EUR 471

Mouse PPME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PPME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF005466 96 Tests
EUR 689

Human PPME1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PPME1 protein (His tag)

80R-1904 100 ug
EUR 305
Description: Purified recombinant PPME1 protein

PPME1 Recombinant Protein (Human)

RP024325 100 ug Ask for price

PPME1 Recombinant Protein (Rat)

RP221675 100 ug Ask for price


PVT12662 2 ug
EUR 703

PPME1 Recombinant Protein (Mouse)

RP163835 100 ug Ask for price

Protein Phosphatase Methylesterase 1 (PPME1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Phosphatase Methylesterase 1 (PPME1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PPME1 ORF Vector (Human) (pORF)

ORF008109 1.0 ug DNA
EUR 95

Ppme1 ORF Vector (Rat) (pORF)

ORF073893 1.0 ug DNA
EUR 506

Ppme1 ORF Vector (Mouse) (pORF)

ORF054613 1.0 ug DNA
EUR 506

PPME1 ELISA Kit (Rat) (OKEH03629)

OKEH03629 96 Wells
EUR 779
Description: Description of target: Demethylates proteins that have been reversibly carboxymethylated. Demethylates PPP2CB (in vitro) and PPP2CA. Binding to PPP2CA displaces the manganese ion and inactivates the enzyme.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.325 ng/mL

PPME1 sgRNA CRISPR Lentivector set (Human)

K1701501 3 x 1.0 ug
EUR 339

Ppme1 sgRNA CRISPR Lentivector set (Mouse)

K3733801 3 x 1.0 ug
EUR 339

Ppme1 sgRNA CRISPR Lentivector set (Rat)

K6404301 3 x 1.0 ug
EUR 339

PPME1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1701502 1.0 ug DNA
EUR 154

PPME1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1701503 1.0 ug DNA
EUR 154

PPME1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1701504 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3733802 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3733803 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3733804 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6404302 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6404303 1.0 ug DNA
EUR 154

Ppme1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6404304 1.0 ug DNA
EUR 154

Recombinant Human PPME1 Protein, His, E.coli-1mg

QP13121-1mg 1mg
EUR 2757

Recombinant Human PPME1 Protein, His, E.coli-20ug

QP13121-20ug 20ug
EUR 201

Recombinant Human PPME1 Protein, His, E.coli-5ug

QP13121-5ug 5ug
EUR 155

PPME1 Protein Vector (Human) (pPB-C-His)

PV032433 500 ng
EUR 329

PPME1 Protein Vector (Human) (pPB-N-His)

PV032434 500 ng
EUR 329

PPME1 Protein Vector (Human) (pPM-C-HA)

PV032435 500 ng
EUR 329

PPME1 Protein Vector (Human) (pPM-C-His)

PV032436 500 ng
EUR 329

PPME1 Protein Vector (Mouse) (pPB-C-His)

PV218450 500 ng
EUR 603

PPME1 Protein Vector (Mouse) (pPB-N-His)

PV218451 500 ng
EUR 603

PPME1 Protein Vector (Mouse) (pPM-C-HA)

PV218452 500 ng
EUR 603

PPME1 Protein Vector (Mouse) (pPM-C-His)

PV218453 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPB-C-His)

PV295570 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPB-N-His)

PV295571 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPM-C-HA)

PV295572 500 ng
EUR 603

PPME1 Protein Vector (Rat) (pPM-C-His)

PV295573 500 ng
EUR 603

Ppme1 3'UTR GFP Stable Cell Line

TU166797 1.0 ml Ask for price

PPME1 3'UTR Luciferase Stable Cell Line

TU018616 1.0 ml
EUR 1394

Ppme1 3'UTR Luciferase Stable Cell Line

TU116797 1.0 ml Ask for price

PPME1 3'UTR GFP Stable Cell Line

TU068616 1.0 ml
EUR 1394

Ppme1 3'UTR GFP Stable Cell Line

TU266642 1.0 ml Ask for price

Ppme1 3'UTR Luciferase Stable Cell Line

TU216642 1.0 ml Ask for price

Cow Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx516396-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx516397-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx516398-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Ppme1/ Protein phosphatase methylesterase 1 ELISA Kit

E0785Ra 1 Kit
EUR 646

Mouse Ppme1/ Protein phosphatase methylesterase 1 ELISA Kit

E1180Mo 1 Kit
EUR 632

Human PPME1/ Protein phosphatase methylesterase 1 ELISA Kit

E2010Hu 1 Kit
EUR 605

Rat Ppme1(Protein phosphatase methylesterase 1) ELISA Kit

ER0505 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q4FZT2
  • Alias: Ppme1
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Human Protein phosphatase methylesterase 1, PPME1 ELISA KIT

ELI-36196h 96 Tests
EUR 824

Mouse Protein phosphatase methylesterase 1, Ppme1 ELISA KIT

ELI-36547m 96 Tests
EUR 865

Bovine Protein phosphatase methylesterase 1, PPME1 ELISA KIT

ELI-45446b 96 Tests
EUR 928

Rat Protein phosphatase methylesterase 1 (PPME1) ELISA Kit

abx256482-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

PPME1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV700207 1.0 ug DNA
EUR 682

PPME1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV700211 1.0 ug DNA
EUR 682

PPME1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV700212 1.0 ug DNA
EUR 682

PPME1 Protein Phosphatase Methylesterase 1 Human Recombinant Protein

PROTQ9Y570 Regular: 20ug
EUR 317
Description: PPME1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 406 amino acids (1-386) and having a molecular mass of 44.4 kDa.;The PPME1 is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PPME1 Rabbit Polyclonal Antibody