October 26, 2021

STK3 Rabbit Polyclonal Antibody

STK3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STK3 Polyclonal Antibody

ES10201-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK3 Rabbit pAb

A6992-100ul 100 ul
EUR 308

STK3 Rabbit pAb

A6992-200ul 200 ul
EUR 459

STK3 Rabbit pAb

A6992-20ul 20 ul
EUR 183

STK3 Rabbit pAb

A6992-50ul 50 ul
EUR 223

STK3 antibody

70R-1658 100 ug
EUR 377
Description: Rabbit polyclonal STK3 antibody

STK3 antibody

70R-20595 50 ul
EUR 435
Description: Rabbit polyclonal STK3 antibody

STK3 antibody

10R-1630 50 ug
EUR 242
Description: Mouse monoclonal STK3 antibody

STK3 antibody

10R-5979 100 ul
EUR 726
Description: Mouse monoclonal STK3 antibody

STK3 Antibody

45099-100ul 100ul
EUR 252

STK3 Antibody

45099-50ul 50ul
EUR 187

STK3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STK3. Recognizes STK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

STK3 Antibody

DF7692 200ul
EUR 304
Description: STK3 Antibody detects endogenous levels of total STK3.

STK3 antibody

70R-5936 50 ug
EUR 467
Description: Rabbit polyclonal STK3 antibody

STK3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STK3. Recognizes STK3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

STK3 Antibody

ABD7692 100 ug
EUR 438

Anti-STK3/Mst2 Rabbit Monoclonal Antibody

M02224 100ug/vial
EUR 397
Description: Rabbit Monoclonal STK3/Mst2 Antibody. Validated in IHC, IP, WB and tested in Human, Mouse, Rat.

Polyclonal MST2 / STK3 Antibody (internal region)

APG00800G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MST2 / STK3 (internal region). This antibody is tested and proven to work in the following applications:

Phospho-STK3-T117 Rabbit pAb

AP0934-100ul 100 ul
EUR 384

Phospho-STK3-T117 Rabbit pAb

AP0934-200ul 200 ul
EUR 554

Phospho-STK3-T117 Rabbit pAb

AP0934-20ul 20 ul
EUR 183

Phospho-STK3-T117 Rabbit pAb

AP0934-50ul 50 ul
EUR 265

Phospho-STK3-T384 Rabbit pAb

AP0935-100ul 100 ul
EUR 384

Phospho-STK3-T384 Rabbit pAb

AP0935-200ul 200 ul
EUR 554

Phospho-STK3-T384 Rabbit pAb

AP0935-20ul 20 ul
EUR 183

Phospho-STK3-T384 Rabbit pAb

AP0935-50ul 50 ul
EUR 265

STK3/STK4 Antibody

37462-100ul 100ul
EUR 252

STK3/STK4 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STK3/STK4. Recognizes STK3/STK4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

Mouse Stk3 Antibody

abx028594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Stk3 Antibody

abx028594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

STK3 Conjugated Antibody

C45099 100ul
EUR 397

STK3 / STK4 Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- STK3 antibody

FNab08329 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: serine/threonine kinase 3 (STE20 homolog, yeast)
  • Uniprot ID: Q13188
  • Gene ID: 6788
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK3

Anti-STK3 antibody

PAab08329 100 ug
EUR 386

Anti-STK3 antibody

STJ29072 100 µl
EUR 277
Description: This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-STK3 antibody

STJ191359 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK3

Stk3/ Rat Stk3 ELISA Kit

ELI-52161r 96 Tests
EUR 886

STK3 protein

30R-2865 5 ug
EUR 503
Description: Purified recombinant Human STK3 protein

STK3, Active

EUR 370


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14840 50 ul
EUR 363
Description: Mouse polyclonal to STK3


YF-PA14841 50 ug
EUR 363
Description: Mouse polyclonal to STK3


YF-PA14842 100 ug
EUR 403
Description: Rabbit polyclonal to STK3

STK3/STK4 Conjugated Antibody

C37462 100ul
EUR 397

STK3 / STK4 (pT183) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

STK3 recombinant monoclonal antibody

A5273 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human STK3 for WB,ELISA

Anti-MST2 / STK3 antibody

STJ72739 100 µg
EUR 359

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3)

Phospho-STK3/STK4-T180/T183 Rabbit pAb

AP1094-100ul 100 ul
EUR 384

Phospho-STK3/STK4-T180/T183 Rabbit pAb

AP1094-200ul 200 ul
EUR 554

Phospho-STK3/STK4-T180/T183 Rabbit pAb

AP1094-20ul 20 ul
EUR 183

Phospho-STK3/STK4-T180/T183 Rabbit pAb

AP1094-50ul 50 ul
EUR 265

STK3 Blocking Peptide

33R-3940 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STK3 antibody, catalog no. 70R-1658

STK3 Blocking Peptide

33R-5949 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STK3 antibody, catalog no. 70R-5936

STK3 Blocking Peptide

DF7692-BP 1mg
EUR 195

STK3 cloning plasmid

CSB-CL614396HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1476
  • Sequence: atggagcagccgccggcgcctaagagtaaactaaaaaagctgagtgaagacagtttgactaagcagcctgaagaagtttttgatgtattagagaagcttggagaagggtcttatggaagtgtatttaaagcaatacacaaggaatccggtcaagttgtcgcaattaaacaagtac
  • Show more
Description: A cloning plasmid for the STK3 gene.


PVT12882 2 ug
EUR 391

Anti-STK3 (1E9)

YF-MA15657 100 ug
EUR 363
Description: Mouse monoclonal to STK3

Anti-STK3 (4F7)

YF-MA15658 50 ug
EUR 363
Description: Mouse monoclonal to STK3

Anti-STK3 (4F7)

YF-MA15659 200 ul
EUR 363
Description: Mouse monoclonal to STK3

Phospho-STK3/STK4 (T183) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-STK3/STK4 (T183). Recognizes Phospho-STK3/STK4 (T183) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

Anti-Phospho-STK3-T117 antibody

STJ11101068 100 µl
EUR 393
Description: This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Phospho-STK3-T384 antibody

STJ11101069 100 µl
EUR 393
Description: This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene.

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with APC.

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with Biotin.

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with Cy3.

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with FITC.

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with HRP.

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with PE.

Serine/Threonine Kinase 3 (STK3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 3 (STK3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 3 (STK3) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serine/Threonine Kinase 3 (STK3) Antibody

abx145697-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/Threonine Kinase 3 (STK3) Antibody

abx238329-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine/Threonine Kinase 3 (STK3) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


EF003308 96 Tests
EUR 689

Mouse STK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat STK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human STK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti-STK3(M11) (1B3)

LF-MA10321 100 ug
EUR 363
Description: Mouse monoclonal to STK3(M11)

Serine/Threonine Kinase 3 (STK3) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STK3 (Thr235~Ala460)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Serine/Threonine Kinase 3 (STK3). This antibody is labeled with APC-Cy7.

Monoclonal STK3 Antibody (clone 4G10), Clone: 4G10

AMM02271G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human STK3 (clone 4G10). The antibodies are raised in Mouse and are from clone 4G10. This antibody is applicable in WB and IHC-P

Anti-Phospho-STK3/STK4-T180/T183 antibody

STJ11101128 100 µl
EUR 393

Stk3 ORF Vector (Rat) (pORF)

ORF077155 1.0 ug DNA
EUR 506

h STK3 inducible lentiviral particles

LVP248 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK3, is fully sequence verified and matched to NCBI accession ID: NM_006281

STK3 ORF Vector (Human) (pORF)

ORF010140 1.0 ug DNA
EUR 95

Stk3 ORF Vector (Mouse) (pORF)

ORF058689 1.0 ug DNA
EUR 506

Stk3 sgRNA CRISPR Lentivector set (Rat)

K7120801 3 x 1.0 ug
EUR 339

Stk3 sgRNA CRISPR Lentivector set (Mouse)

K3840701 3 x 1.0 ug
EUR 339

STK3 sgRNA CRISPR Lentivector set (Human)

K2302501 3 x 1.0 ug
EUR 339

Recombinant Serine/Threonine Kinase 3 (STK3)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JI10
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8KDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Serine/Threonine Kinase 3 expressed in: E.coli

Mouse Serine/Threonine Kinase 3 (STK3) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Stk3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7120802 1.0 ug DNA
EUR 154

Stk3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7120803 1.0 ug DNA
EUR 154

Stk3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7120804 1.0 ug DNA
EUR 154

Stk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3840702 1.0 ug DNA
EUR 154

Stk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3840703 1.0 ug DNA
EUR 154

Stk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3840704 1.0 ug DNA
EUR 154

STK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2302502 1.0 ug DNA
EUR 154

STK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2302503 1.0 ug DNA
EUR 154

STK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2302504 1.0 ug DNA
EUR 154

STK3 Protein Vector (Rat) (pPB-C-His)

PV308618 500 ng
EUR 603

STK3 Protein Vector (Rat) (pPB-N-His)

PV308619 500 ng
EUR 603

STK3 Protein Vector (Rat) (pPM-C-HA)

PV308620 500 ng
EUR 603

STK3 Protein Vector (Rat) (pPM-C-His)

PV308621 500 ng
EUR 603

STK3 Protein Vector (Human) (pPB-C-His)

PV040557 500 ng
EUR 329

STK3 Protein Vector (Human) (pPB-N-His)

PV040558 500 ng
EUR 329

STK3 Protein Vector (Human) (pPM-C-HA)

PV040559 500 ng
EUR 329

STK3 Protein Vector (Human) (pPM-C-His)

PV040560 500 ng
EUR 329

STK3 Protein Vector (Mouse) (pPB-C-His)

PV234754 500 ng
EUR 603

STK3 Protein Vector (Mouse) (pPB-N-His)

PV234755 500 ng
EUR 603

STK3 Protein Vector (Mouse) (pPM-C-HA)

PV234756 500 ng
EUR 603

STK3 Protein Vector (Mouse) (pPM-C-His)

PV234757 500 ng
EUR 603

Recombinant Human STK3 Protein, His, Insect-10ug

QP13619-10ug 10ug
EUR 201

Recombinant Human STK3 Protein, His, Insect-1mg

QP13619-1mg 1mg
EUR 5251

Recombinant Human STK3 Protein, His, Insect-2ug

QP13619-2ug 2ug
EUR 155

Stk3 3'UTR Luciferase Stable Cell Line

TU119847 1.0 ml Ask for price

Stk3 3'UTR GFP Stable Cell Line

TU169847 1.0 ml Ask for price

Stk3 3'UTR Luciferase Stable Cell Line

TU221314 1.0 ml Ask for price

STK3 3'UTR GFP Stable Cell Line

TU074808 1.0 ml
EUR 1394

Stk3 3'UTR GFP Stable Cell Line

TU271314 1.0 ml Ask for price

STK3 3'UTR Luciferase Stable Cell Line

TU024808 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

STK3 Rabbit Polyclonal Antibody