October 17, 2021

NOL9 Rabbit Polyclonal Antibody

NOL9 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NOL9 Polyclonal Antibody
ABP59495-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of NOL9 from Human, Mouse. This NOL9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720
NOL9 Polyclonal Antibody
ABP59495-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of NOL9 from Human, Mouse. This NOL9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720
NOL9 Polyclonal Antibody
ES9958-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOL9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
NOL9 Polyclonal Antibody
ES9958-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOL9 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
NOL9 Rabbit pAb
A9160-100ul 100 ul
EUR 308
NOL9 Rabbit pAb
A9160-200ul 200 ul
EUR 459
NOL9 Rabbit pAb
A9160-20ul 20 ul Ask for price
NOL9 Rabbit pAb
A9160-50ul 50 ul Ask for price
NOL9 Antibody
36222-100ul 100ul
EUR 252
NOL9 Antibody
DF9721 200ul
EUR 304
Description: NOL9 Antibody detects endogenous levels of total NOL9.
NOL9 Antibody
1-CSB-PA150875
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOL9. Recognizes NOL9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
NOL9 Antibody
ABD9721 100 ug
EUR 438
Polyclonal NOL9 Antibody (C-term)
APR06213G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL9 (C-term). This antibody is tested and proven to work in the following applications:
NOL9 Conjugated Antibody
C36222 100ul
EUR 397
anti- NOL9 antibody
FNab05789 100µg
EUR 585
  • Immunogen: nucleolar protein 9
  • Uniprot ID: Q5SY16
  • Gene ID: 79707
  • Research Area: Metabolism
Description: Antibody raised against NOL9
Anti-NOL9 antibody
PAab05789 100 ug
EUR 412
Anti-NOL9 antibody
STJ111591 100 µl
EUR 277
Anti-NOL9 antibody
STJ191116 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOL9
NOL9 siRNA
20-abx926132
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NOL9 siRNA
20-abx926133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NOL9 Blocking Peptide
DF9721-BP 1mg
EUR 195
NOL9 cloning plasmid
CSB-CL725557HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2109
  • Sequence: ATGGCGGACTCGGGACTGCTGCTAAAGTGGGGTTCCTGCCGTTCCACTTGGCTGCGGGTCCGCAAGGCCCGGCCCCAGCTCATCCTCAGCCGCCGGCCCCGCCGCCGGCTCGGGAGCCTGCGCTGGTGCGGTCGGCGGCGCCTACGGCGGCGGTTACTGCAAGCCCAGGCGGCCG
  • Show more
Description: A cloning plasmid for the NOL9 gene.
Nucleolar Protein 9 (NOL9) Antibody
20-abx211330
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Nucleolar Protein 9 (NOL9) Antibody
20-abx124786
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Nucleolar Protein 9 (NOL9) Antibody
abx122121-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Nucleolar Protein 9 (NOL9) Antibody
abx034569-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Nucleolar Protein 9 (NOL9) Antibody
abx034569-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Nucleolar Protein 9 (NOL9) Antibody
abx235789-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Human Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT
ELI-15001h 96 Tests
EUR 824
Mouse Polynucleotide 5'- hydroxyl- kinase NOL9, Nol9 ELISA KIT
ELI-44124m 96 Tests
EUR 865
Bovine Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT
ELI-44672b 96 Tests
EUR 928
NOL9 ELISA KIT|Human
EF001279 96 Tests
EUR 689
Mouse NOL9 shRNA Plasmid
20-abx978066
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human NOL9 shRNA Plasmid
20-abx962501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NOL9 Recombinant Protein (Human)
RP041680 100 ug Ask for price
NOL9 Recombinant Protein (Mouse)
RP154532 100 ug Ask for price
NOL9 Recombinant Protein (Mouse)
RP154535 100 ug Ask for price
NOL9 ORF Vector (Human) (pORF)
ORF013894 1.0 ug DNA
EUR 354
Nol9 ORF Vector (Mouse) (pORF)
ORF051512 1.0 ug DNA
EUR 506
Nol9 ORF Vector (Mouse) (pORF)
ORF051513 1.0 ug DNA
EUR 506
Nol9 sgRNA CRISPR Lentivector set (Mouse)
K4769401 3 x 1.0 ug
EUR 339
NOL9 sgRNA CRISPR Lentivector set (Human)
K1439401 3 x 1.0 ug
EUR 339
Human Nucleolar Protein 9 (NOL9) ELISA Kit
abx381843-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4769402 1.0 ug DNA
EUR 154
Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4769403 1.0 ug DNA
EUR 154
Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4769404 1.0 ug DNA
EUR 154
NOL9 sgRNA CRISPR Lentivector (Human) (Target 1)
K1439402 1.0 ug DNA
EUR 154
NOL9 sgRNA CRISPR Lentivector (Human) (Target 2)
K1439403 1.0 ug DNA
EUR 154
NOL9 sgRNA CRISPR Lentivector (Human) (Target 3)
K1439404 1.0 ug DNA
EUR 154
NOL9 Protein Vector (Mouse) (pPB-C-His)
PV206046 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPB-N-His)
PV206047 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPM-C-HA)
PV206048 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPM-C-His)
PV206049 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPB-C-His)
PV206050 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPB-N-His)
PV206051 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPM-C-HA)
PV206052 500 ng
EUR 1065
NOL9 Protein Vector (Mouse) (pPM-C-His)
PV206053 500 ng
EUR 1065
Human Nucleolar Protein 9(NOL9)ELISA Kit
QY-E03186 96T
EUR 361
NOL9 Protein Vector (Human) (pPB-C-His)
PV055573 500 ng
EUR 481
NOL9 Protein Vector (Human) (pPB-N-His)
PV055574 500 ng
EUR 481
NOL9 Protein Vector (Human) (pPM-C-HA)
PV055575 500 ng
EUR 481
NOL9 Protein Vector (Human) (pPM-C-His)
PV055576 500 ng
EUR 481
Nol9 3'UTR Luciferase Stable Cell Line
TU214075 1.0 ml Ask for price
Nol9 3'UTR GFP Stable Cell Line
TU264075 1.0 ml Ask for price
NOL9 3'UTR GFP Stable Cell Line
TU065809 1.0 ml
EUR 2333
NOL9 3'UTR Luciferase Stable Cell Line
TU015809 1.0 ml
EUR 2333
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

NOL9 Rabbit Polyclonal Antibody