October 28, 2021

RHOQ Rabbit Polyclonal Antibody

RHOQ Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RHOQ Polyclonal Antibody
ES10177-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RHOQ from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
RHOQ Polyclonal Antibody
ABP60171-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
RHOQ Polyclonal Antibody
ABP60171-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
RHOQ Polyclonal Antibody
ABP60171-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
RHOQ Rabbit pAb
A17401-100ul 100 ul Ask for price
RHOQ Rabbit pAb
A17401-200ul 200 ul Ask for price
RHOQ Rabbit pAb
A17401-20ul 20 ul Ask for price
RHOQ Rabbit pAb
A17401-50ul 50 ul
EUR 384
RHOQ Antibody
ABD7643 100 ug
EUR 438
RHOQ Antibody
45090-100ul 100ul
EUR 252
RHOQ Antibody
45090-50ul 50ul
EUR 187
RHOQ antibody
70R-19889 50 ul
EUR 435
Description: Rabbit polyclonal RHOQ antibody
RHOQ Antibody
DF7643 200ul
EUR 304
Description: RHOQ Antibody detects endogenous levels of total RHOQ.
RHOQ Antibody
1-CSB-PA019693GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RHOQ. Recognizes RHOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
Rhoq/ Rat Rhoq ELISA Kit
ELI-45212r 96 Tests
EUR 886
RHOQ Conjugated Antibody
C45090 100ul
EUR 397
Anti-RHOQ antibody
STJ119523 50 µl
EUR 393
Description: NA
Anti-RHOQ antibody
STJ191335 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RHOQ
RHOQ siRNA
20-abx904571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RHOQ siRNA
20-abx931484
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RHOQ siRNA
20-abx931485
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Rho-Related GTP-Binding Protein RhoQ (RHOQ) Protein
20-abx262613
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RHOQ cloning plasmid
CSB-CL019693HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCT
  • Show more
Description: A cloning plasmid for the RHOQ gene.
RHOQ Blocking Peptide
DF7643-BP 1mg
EUR 195
pCMV-SPORT6-RHOQ
PVT14161 2 ug
EUR 495
Human Rho- related GTP- binding protein RhoQ, RHOQ ELISA KIT
ELI-18505h 96 Tests
EUR 824
Mouse Rho- related GTP- binding protein RhoQ, Rhoq ELISA KIT
ELI-38885m 96 Tests
EUR 865
Mouse RHOQ shRNA Plasmid
20-abx979628
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RHOQ shRNA Plasmid
20-abx987025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human RHOQ shRNA Plasmid
20-abx958268
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RHOQ protein (His tag)
80R-2786 50 ug
EUR 322
Description: Purified recombinant RHOQ protein (His tag)
RhoQ Recombinant Protein (Human)
RP042877 100 ug Ask for price
RhoQ Recombinant Protein (Rat)
RP226058 100 ug Ask for price
RhoQ Recombinant Protein (Mouse)
RP168041 100 ug Ask for price
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human)
4-PAE328Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ)
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC
4-PAE328Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Biotinylated
4-PAE328Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Biotin.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Cy3
4-PAE328Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Cy3.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), FITC
4-PAE328Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with FITC.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), HRP
4-PAE328Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with HRP.
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), PE
4-PAE328Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with PE.
Rhoq ORF Vector (Mouse) (pORF)
ORF056015 1.0 ug DNA
EUR 506
Rhoq ORF Vector (Rat) (pORF)
ORF075354 1.0 ug DNA
EUR 506
RHOQ ORF Vector (Human) (pORF)
ORF014293 1.0 ug DNA
EUR 354
Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC-Cy7
4-PAE328Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RHOQ (Met1~Cys202)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC-Cy7.
Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx129116
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ras Homolog Gene Family, Member Q (RHOQ) Antibody
abx146452-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ras Homolog Gene Family, Member Q (RHOQ) Antibody
20-abx218294
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RhoQ sgRNA CRISPR Lentivector set (Human)
K0004301 3 x 1.0 ug
EUR 339
Rhoq sgRNA CRISPR Lentivector set (Mouse)
K3253301 3 x 1.0 ug
EUR 339
Rhoq sgRNA CRISPR Lentivector set (Rat)
K6994901 3 x 1.0 ug
EUR 339
RhoQ sgRNA CRISPR Lentivector (Human) (Target 1)
K0004302 1.0 ug DNA
EUR 154
RhoQ sgRNA CRISPR Lentivector (Human) (Target 2)
K0004303 1.0 ug DNA
EUR 154
RhoQ sgRNA CRISPR Lentivector (Human) (Target 3)
K0004304 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3253302 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3253303 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3253304 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Rat) (Target 1)
K6994902 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Rat) (Target 2)
K6994903 1.0 ug DNA
EUR 154
Rhoq sgRNA CRISPR Lentivector (Rat) (Target 3)
K6994904 1.0 ug DNA
EUR 154
RhoQ Protein Vector (Human) (pPB-C-His)
PV057169 500 ng
EUR 481
RhoQ Protein Vector (Human) (pPB-N-His)
PV057170 500 ng
EUR 481
RhoQ Protein Vector (Human) (pPM-C-HA)
PV057171 500 ng
EUR 481
RhoQ Protein Vector (Human) (pPM-C-His)
PV057172 500 ng
EUR 481
Recombinant Human RHOQ Protein, His, E.coli-10ug
QP13319-10ug 10ug
EUR 201
Recombinant Human RHOQ Protein, His, E.coli-1mg
QP13319-1mg 1mg
EUR 5251
Recombinant Human RHOQ Protein, His, E.coli-2ug
QP13319-2ug 2ug
EUR 155
RhoQ Protein Vector (Rat) (pPB-C-His)
PV301414 500 ng
EUR 603
RhoQ Protein Vector (Rat) (pPB-N-His)
PV301415 500 ng
EUR 603
RhoQ Protein Vector (Rat) (pPM-C-HA)
PV301416 500 ng
EUR 603
RhoQ Protein Vector (Rat) (pPM-C-His)
PV301417 500 ng
EUR 603
RhoQ Protein Vector (Mouse) (pPB-C-His)
PV224058 500 ng
EUR 603
RhoQ Protein Vector (Mouse) (pPB-N-His)
PV224059 500 ng
EUR 603
RhoQ Protein Vector (Mouse) (pPM-C-HA)
PV224060 500 ng
EUR 603
RhoQ Protein Vector (Mouse) (pPM-C-His)
PV224061 500 ng
EUR 603
Rhoq 3'UTR GFP Stable Cell Line
TU167838 1.0 ml Ask for price
RHOQ 3'UTR Luciferase Stable Cell Line
TU019888 1.0 ml
EUR 1521
Rhoq 3'UTR Luciferase Stable Cell Line
TU117838 1.0 ml Ask for price
RHOQ 3'UTR GFP Stable Cell Line
TU069888 1.0 ml
EUR 1521
Rhoq 3'UTR Luciferase Stable Cell Line
TU219412 1.0 ml Ask for price
Rhoq 3'UTR GFP Stable Cell Line
TU269412 1.0 ml Ask for price
RhoQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691249 1.0 ug DNA
EUR 514
RhoQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV691253 1.0 ug DNA
EUR 514
RhoQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV691254 1.0 ug DNA
EUR 514
Recombinant Ras Homolog Gene Family, Member Q (RHOQ)
4-RPE328Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17081
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 52.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Ras Homolog Gene Family, Member Q expressed in: E.coli
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RHOQ Rabbit Polyclonal Antibody