RHOQ Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 RHOQ Polyclonal Antibody |
|
ES10177-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RHOQ from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
RHOQ Polyclonal Antibody |
|
ABP60171-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140 |
|
RHOQ Polyclonal Antibody |
|
ABP60171-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140 |
|
RHOQ Polyclonal Antibody |
|
ABP60171-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RHOQ from Human, Mouse, Rat. This RHOQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOQ protein at amino acid sequence of 60-140 |
 RHOQ Rabbit pAb |
|
A17401-100ul |
Abclonal |
100 ul |
Ask for price |
|
RHOQ Rabbit pAb |
|
A17401-200ul |
Abclonal |
200 ul |
Ask for price |
|
RHOQ Rabbit pAb |
|
A17401-20ul |
Abclonal |
20 ul |
Ask for price |
|
RHOQ Rabbit pAb |
|
A17401-50ul |
Abclonal |
50 ul |
EUR 384 |
 RHOQ Antibody |
|
45090-100ul |
SAB |
100ul |
EUR 252 |
|
RHOQ Antibody |
|
45090-50ul |
SAB |
50ul |
EUR 187 |
 RHOQ antibody |
|
70R-19889 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RHOQ antibody |
|
RHOQ Antibody |
|
DF7643 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RHOQ Antibody detects endogenous levels of total RHOQ. |
|
RHOQ Antibody |
|
1-CSB-PA019693GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against RHOQ. Recognizes RHOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 RHOQ Conjugated Antibody |
|
C45090 |
SAB |
100ul |
EUR 397 |
 Anti-RHOQ antibody |
|
STJ191335 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RHOQ |
 RHOQ siRNA |
|
20-abx904571 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
RHOQ siRNA |
|
20-abx931484 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
RHOQ siRNA |
|
20-abx931485 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Protein) Rho-Related GTP-Binding Protein RhoQ (RHOQ) Protein |
|
20-abx262613 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 RHOQ cloning plasmid |
|
CSB-CL019693HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 618
- Sequence: ATGGCTCACGGGCCCGGCGCGCTGATGCTCAAGTGCGTGGTGGTCGGCGACGGGGCGGTGGGCAAGACGTGCCTACTCATGAGCTATGCCAACGACGCCTTCCCGGAGGAGTACGTGCCCACCGTCTTCGACCACTACGCAGTCAGCGTCACCGTGGGGGGCAAGCAGTACCTCCT
- Show more
|
|
Description: A cloning plasmid for the RHOQ gene. |
 RHOQ Blocking Peptide |
|
DF7643-BP |
Affbiotech |
1mg |
EUR 195 |
 Human Rho- related GTP- binding protein RhoQ, RHOQ ELISA KIT |
|
ELI-18505h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Rho- related GTP- binding protein RhoQ, Rhoq ELISA KIT |
|
ELI-38885m |
Lifescience Market |
96 Tests |
EUR 865 |
 Mouse RHOQ shRNA Plasmid |
|
20-abx979628 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat RHOQ shRNA Plasmid |
|
20-abx987025 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RHOQ shRNA Plasmid |
|
20-abx958268 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RHOQ protein (His tag) |
|
80R-2786 |
Fitzgerald |
50 ug |
EUR 322 |
|
Description: Purified recombinant RHOQ protein (His tag) |
) RhoQ Recombinant Protein (Human) |
|
RP042877 |
ABM |
100 ug |
Ask for price |
) RhoQ Recombinant Protein (Rat) |
|
RP226058 |
ABM |
100 ug |
Ask for price |
) RhoQ Recombinant Protein (Mouse) |
|
RP168041 |
ABM |
100 ug |
Ask for price |
 Polyclonal Antibody (Human)) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human) |
|
4-PAE328Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ) |
 Polyclonal Antibody (Human), APC) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC |
|
4-PAE328Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Biotinylated |
|
4-PAE328Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), Cy3 |
|
4-PAE328Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), FITC |
|
4-PAE328Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), HRP |
|
4-PAE328Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), PE |
|
4-PAE328Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with PE. |
 (pORF)) Rhoq ORF Vector (Mouse) (pORF) |
|
ORF056015 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Rhoq ORF Vector (Rat) (pORF) |
|
ORF075354 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) RHOQ ORF Vector (Human) (pORF) |
|
ORF014293 |
ABM |
1.0 ug DNA |
EUR 354 |
 Polyclonal Antibody (Human), APC-Cy7) Ras Homolog Gene Family, Member Q (RHOQ) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAE328Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RHOQ (Met1~Cys202)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human Ras Homolog Gene Family, Member Q (RHOQ). This antibody is labeled with APC-Cy7. |
 Antibody) Ras Homolog Gene Family, Member Q (RHOQ) Antibody |
|
20-abx129116 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
|
Ras Homolog Gene Family, Member Q (RHOQ) Antibody |
|
abx146452-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
|
Ras Homolog Gene Family, Member Q (RHOQ) Antibody |
|
20-abx218294 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) RhoQ sgRNA CRISPR Lentivector set (Human) |
|
K0004301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rhoq sgRNA CRISPR Lentivector set (Mouse) |
|
K3253301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rhoq sgRNA CRISPR Lentivector set (Rat) |
|
K6994901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RhoQ sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0004302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RhoQ sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0004303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RhoQ sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0004304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3253302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3253303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rhoq sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3253304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rhoq sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6994902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rhoq sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6994903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rhoq sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6994904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RhoQ Protein Vector (Human) (pPB-C-His) |
|
PV057169 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) RhoQ Protein Vector (Human) (pPB-N-His) |
|
PV057170 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) RhoQ Protein Vector (Human) (pPM-C-HA) |
|
PV057171 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) RhoQ Protein Vector (Human) (pPM-C-His) |
|
PV057172 |
ABM |
500 ng |
EUR 481 |
 Recombinant Human RHOQ Protein, His, E.coli-10ug |
|
QP13319-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human RHOQ Protein, His, E.coli-1mg |
|
QP13319-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human RHOQ Protein, His, E.coli-2ug |
|
QP13319-2ug |
EnQuireBio |
2ug |
EUR 155 |
 (pPB-C-His)) RhoQ Protein Vector (Rat) (pPB-C-His) |
|
PV301414 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RhoQ Protein Vector (Rat) (pPB-N-His) |
|
PV301415 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RhoQ Protein Vector (Rat) (pPM-C-HA) |
|
PV301416 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RhoQ Protein Vector (Rat) (pPM-C-His) |
|
PV301417 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) RhoQ Protein Vector (Mouse) (pPB-C-His) |
|
PV224058 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) RhoQ Protein Vector (Mouse) (pPB-N-His) |
|
PV224059 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) RhoQ Protein Vector (Mouse) (pPM-C-HA) |
|
PV224060 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) RhoQ Protein Vector (Mouse) (pPM-C-His) |
|
PV224061 |
ABM |
500 ng |
EUR 603 |
 Rhoq 3'UTR GFP Stable Cell Line |
|
TU167838 |
ABM |
1.0 ml |
Ask for price |
 RHOQ 3'UTR Luciferase Stable Cell Line |
|
TU019888 |
ABM |
1.0 ml |
EUR 1521 |
 Rhoq 3'UTR Luciferase Stable Cell Line |
|
TU117838 |
ABM |
1.0 ml |
Ask for price |
 RHOQ 3'UTR GFP Stable Cell Line |
|
TU069888 |
ABM |
1.0 ml |
EUR 1521 |
|
Rhoq 3'UTR Luciferase Stable Cell Line |
|
TU219412 |
ABM |
1.0 ml |
Ask for price |
|
Rhoq 3'UTR GFP Stable Cell Line |
|
TU269412 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) RhoQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV691249 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) RhoQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV691253 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) RhoQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV691254 |
ABM |
1.0 ug DNA |
EUR 514 |
) Recombinant Ras Homolog Gene Family, Member Q (RHOQ) |
|
4-RPE328Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P17081
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 52.3kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Ras Homolog Gene Family, Member Q expressed in: E.coli |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
|
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
RHOQ Rabbit Polyclonal Antibody
Rhoq/ Rat Rhoq ELISA Kit 
pCMV-SPORT6-RHOQ 