October 23, 2021

CCL25 Rabbit Polyclonal Antibody

CCL25 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

CCL25 Polyclonal Antibody

ES10267-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

CCL25 Polyclonal Antibody

ABP58014-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110

CCL25 Polyclonal Antibody

ABP58014-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110

CCL25 Polyclonal Antibody

ABP58014-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110

Ccl25 Polyclonal Antibody

A53085 100 µg
EUR 570.55
Description: kits suitable for this type of research

CCL25 Rabbit pAb

A2685-100ul 100 ul
EUR 308

CCL25 Rabbit pAb

A2685-200ul 200 ul
EUR 459

CCL25 Rabbit pAb

A2685-20ul 20 ul
EUR 183

CCL25 Rabbit pAb

A2685-50ul 50 ul
EUR 223

CCL25 Rabbit pAb

A6543-100ul 100 ul
EUR 308

CCL25 Rabbit pAb

A6543-200ul 200 ul
EUR 459

CCL25 Rabbit pAb

A6543-20ul 20 ul
EUR 183

CCL25 Rabbit pAb

A6543-50ul 50 ul
EUR 223

CCL25 antibody

38996-100ul 100ul
EUR 252

CCL25 Antibody

42700-100ul 100ul
EUR 252

CCL25 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Ccl25 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

CCL25 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Ccl25 Polyclonal Antibody, Biotin Conjugated

A53082 100 µg
EUR 570.55
Description: The best epigenetics products

Ccl25 Polyclonal Antibody, FITC Conjugated

A53083 100 µg
EUR 570.55
Description: kits suitable for this type of research

Ccl25 Polyclonal Antibody, HRP Conjugated

A53084 100 µg
EUR 570.55
Description: fast delivery possible

CCL25 Conjugated Antibody

C38996 100ul
EUR 397

Anti-CCL25 antibody

STJ28626 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.

Anti-CCL25 antibody

STJ116184 100 µl
EUR 277
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.

Anti-CCL25 antibody

STJ191425 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL25


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti- CCL25/TECK antibody

FNab01381 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) ligand 25
  • Uniprot ID: O15444
  • Gene ID: 6370
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against CCL25/TECK

Ccl25 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Ccl25 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Ccl25 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CCL25/TECK antibody

PAab01381 100 ug
EUR 355

CCL25 cloning plasmid

CSB-CL004789HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 453
  • Sequence: atgaacctgtggctcctggcctgcctggtggccggcttcctgggagcctgggcccccgctgtccacacccaaggtgtctttgaggactgctgcctggcctaccactaccccattgggtgggctgtgctccggcgcgcctggacttaccggatccaggaggtgagcgggagctgcaa
  • Show more
Description: A cloning plasmid for the CCL25 gene.

TECK/CCL25, Human

HY-P7294 50ug
EUR 497

TECK, CCL25, human

RC315-36 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

CCL25, murine (mouse)

RC335-36 5ug
EUR 101.33
  • Product category: Proteins/Recombinant Proteins/Cytokines

Thymus Expressed Chemokine (CCL25) Antibody

abx231381-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rabbit Thymus Expressed Chemokine / TECK (CCL25) ELISA Kit

abx363170-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human CCL25 ELISA Kit

ELA-E1248h 96 Tests
EUR 824


EF000124 96 Tests
EUR 689


ELI-04127d 96 Tests
EUR 928

Human CCL25 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CCL25 protein (His tag)

80R-4131 100 ug
EUR 327
Description: Recombinant Human CCL25 protein (His tag)

TECK (CCL25), human recombinant

EUR 207

TECK (CCL25), human recombinant

EUR 675

Mouse CCL25 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

C-C Motif Chemokine 25 (CCL25) Antibody

abx412122-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Recombinant Human TECK (CCL25) Protein

PROTO15444-2 20ug
EUR 317
Description: TECK is a CC chemokine, specifically expressed by thymic stromal cells, and signals through the CCR9 receptor. TECK is chemotactic towards activated macrophages, thymocytes and dendritic cells. Recombinant human TECK is a 14.2 kDa protein containing 127 amino acid residues, including the four conserved cysteine residues present in CC chemokines.

Ccl25 ORF Vector (Mouse) (pORF)

ORF040692 1.0 ug DNA
EUR 506

CCL25 ORF Vector (Human) (pORF)

ORF012615 1.0 ug DNA
EUR 354

Ccl25 ORF Vector (Rat) (pORF)

ORF064552 1.0 ug DNA
EUR 506

CCL25 Rabbit Polyclonal Antibody