STAC Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 STAC Polyclonal Antibody |
|
ABP60530-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STAC protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein |
STAC Polyclonal Antibody |
|
ABP60530-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STAC protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein |
STAC Polyclonal Antibody |
|
ABP60530-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STAC protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein |
STAC Polyclonal Antibody |
|
ES10244-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against STAC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STAC Polyclonal Antibody |
|
ES10244-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against STAC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 STAC Rabbit pAb |
|
A15319-100ul |
Abclonal |
100 ul |
EUR 308 |
STAC Rabbit pAb |
|
A15319-200ul |
Abclonal |
200 ul |
EUR 459 |
STAC Rabbit pAb |
|
A15319-20ul |
Abclonal |
20 ul |
EUR 183 |
STAC Rabbit pAb |
|
A15319-50ul |
Abclonal |
50 ul |
EUR 223 |
 STAC Polyclonal Conjugated Antibody |
|
C28912 |
SAB |
100ul |
EUR 397 |
 STAC antibody |
|
70R-20558 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal STAC antibody |
 STAC Antibody |
|
1-CSB-PA859100LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
STAC Antibody |
|
1-CSB-PA022782GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against STAC. Recognizes STAC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
) Polyclonal STAC Antibody (C-term) |
|
APR13560G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAC (C-term). This antibody is tested and proven to work in the following applications: |
 anti- STAC antibody |
|
FNab08278 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: SH3 and cysteine rich domain
- Uniprot ID: Q99469
- Gene ID: 6769
- Research Area: Neuroscience, Signal Transduction
|
|
Description: Antibody raised against STAC |
 Anti-STAC antibody |
|
STJ191402 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to STAC |
 STAC siRNA |
|
20-abx935365 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STAC siRNA |
|
20-abx935366 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-STAC |
|
YF-PA14809 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to STAC |
anti-STAC |
|
YF-PA14810 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to STAC |
anti-STAC |
|
YF-PA24778 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to STAC |
 STAC Antibody, HRP conjugated |
|
1-CSB-PA859100LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 STAC Antibody, FITC conjugated |
|
1-CSB-PA859100LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 STAC Antibody, Biotin conjugated |
|
1-CSB-PA859100LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 STAC cloning plasmid |
|
CSB-CL859100HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1209
- Sequence: atgatccctccgagcagcccccgcgaggacggcgtggacgggctgcccaaggaggcggtgggcgccgagcaaccgccctctcctgcatccaccagcagccaggaatccaagctccagaaactaaaacgatcactttctttcaagaccaagagtttacggagcaaaagtgctgaca
- Show more
|
|
Description: A cloning plasmid for the STAC gene. |
) Anti-STAC (2C5) |
|
YF-MA15632 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to STAC |
) STAC protein (His tag) |
|
80R-3877 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Purified recombinant STAC protein (His tag) |
STAC Rabbit Polyclonal Antibody
