January 17, 2022

STAC Rabbit Polyclonal Antibody

STAC Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STAC Polyclonal Antibody

ABP60530-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STAC protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein

STAC Polyclonal Antibody

ABP60530-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STAC protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein

STAC Polyclonal Antibody

ABP60530-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STAC protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein

STAC Polyclonal Antibody

ES10244-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STAC Polyclonal Antibody

ES10244-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STAC Rabbit pAb

A15319-100ul 100 ul
EUR 308

STAC Rabbit pAb

A15319-200ul 200 ul
EUR 459

STAC Rabbit pAb

A15319-20ul 20 ul
EUR 183

STAC Rabbit pAb

A15319-50ul 50 ul
EUR 223

STAC Polyclonal Conjugated Antibody

C28912 100ul
EUR 397

STAC antibody

70R-20558 50 ul
EUR 435
Description: Rabbit polyclonal STAC antibody

STAC Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

STAC Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAC. Recognizes STAC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal STAC Antibody (C-term)

APR13560G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAC (C-term). This antibody is tested and proven to work in the following applications:

anti- STAC antibody

FNab08278 100µg
EUR 548.75
  • Immunogen: SH3 and cysteine rich domain
  • Uniprot ID: Q99469
  • Gene ID: 6769
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against STAC

Anti-STAC antibody

PAab08278 100 ug
EUR 386

Anti-STAC antibody

STJ117514 100 µl
EUR 277

Anti-STAC antibody

STJ191402 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STAC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14809 50 ug
EUR 363
Description: Mouse polyclonal to STAC


YF-PA14810 100 ug
EUR 403
Description: Rabbit polyclonal to STAC


YF-PA24778 50 ul
EUR 334
Description: Mouse polyclonal to STAC

STAC Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STAC Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STAC Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STAC cloning plasmid

CSB-CL859100HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1209
  • Sequence: atgatccctccgagcagcccccgcgaggacggcgtggacgggctgcccaaggaggcggtgggcgccgagcaaccgccctctcctgcatccaccagcagccaggaatccaagctccagaaactaaaacgatcactttctttcaagaccaagagtttacggagcaaaagtgctgaca
  • Show more
Description: A cloning plasmid for the STAC gene.

Anti-STAC (2C5)

YF-MA15632 100 ug
EUR 363
Description: Mouse monoclonal to STAC

STAC protein (His tag)

80R-3877 100 ug
EUR 327
Description: Purified recombinant STAC protein (His tag)


ELI-18152h 96 Tests
EUR 824


EF003275 96 Tests
EUR 689

STAC Rabbit Polyclonal Antibody