October 23, 2021

RGS4 Rabbit Polyclonal Antibody

RGS4 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RGS4 Polyclonal Antibody
ABP60158-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RGS4 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RGS4 from Human, Mouse, Rat. This RGS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS4 protein at amino acid sequence of 80-160

RGS4 Polyclonal Antibody
ABP60158-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RGS4 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RGS4 from Human, Mouse, Rat. This RGS4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS4 protein at amino acid sequence of 80-160

RGS4 Polyclonal Antibody
ES10151-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RGS4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS4 Polyclonal Antibody
ES10151-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RGS4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RGS4 Rabbit pAb
A1787-100ul 100 ul
EUR 308

RGS4 Rabbit pAb
A1787-200ul 200 ul
EUR 459

RGS4 Rabbit pAb
A1787-20ul 20 ul
EUR 183

RGS4 Rabbit pAb
A1787-50ul 50 ul
EUR 223

RGS4 Rabbit pAb
A16423-100ul 100 ul
EUR 308

RGS4 Rabbit pAb
A16423-200ul 200 ul
EUR 459

RGS4 Rabbit pAb
A16423-20ul 20 ul
EUR 183

RGS4 Rabbit pAb
A16423-50ul 50 ul
EUR 223

RGS4 antibody
22897-100ul 100ul
EUR 390

RGS4 antibody
70R-13592 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RGS4 antibody

RGS4 antibody
70R-19877 50 ul
EUR 435
Description: Rabbit polyclonal RGS4 antibody

RGS4 Antibody
42733-100ul 100ul
EUR 252

RGS4 Antibody
1-CSB-PA920081
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RGS4 Antibody
DF9849 200ul
EUR 304
Description: RGS4 Antibody detects endogenous levels of total RGS4.

RGS4 Antibody
1-CSB-PA449923
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RGS4 antibody
70R-51324 100 ul
EUR 244
Description: Purified Polyclonal RGS4 antibody

RGS4 antibody
70R-5834 50 ug
EUR 467
Description: Rabbit polyclonal RGS4 antibody raised against the C terminal of RGS4

RGS4 Antibody
1-CSB-PA019656GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RGS4 Antibody
1-CSB-PA019656LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RGS4 Antibody
ABD9849 100 ug
EUR 438

Rabbit RGS4 ELISA Kit
ERTR0046 96Tests
EUR 521

RGS4 Polyclonal Antibody, HRP Conjugated
A63331 100 µg
EUR 570.55
Description: kits suitable for this type of research

RGS4 Polyclonal Antibody, FITC Conjugated
A63332 100 µg
EUR 570.55
Description: fast delivery possible

RGS4 Polyclonal Antibody, Biotin Conjugated
A63333 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal RGS4 antibody - C-terminal region
APR00579G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS4 - C-terminal region. This antibody is tested and proven to work in the following applications:

RGS4 Conjugated Antibody
C42733 100ul
EUR 397

anti- RGS4 antibody
FNab07271 100µg
EUR 548.75
  • Immunogen: regulator of G-protein signaling 4
  • Uniprot ID: P49798
  • Gene ID: 5999
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against RGS4

Anti-RGS4 antibody
PAab07271 100 ug
EUR 386

Anti-RGS4 antibody
STJ118863 100 µl
EUR 277

Anti-RGS4 antibody
STJ119881 100 µl
EUR 277
Description: Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% identical to RGS1 and 97% identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene.

Anti-RGS4 antibody
STJ191309 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RGS4

Rgs4/ Rat Rgs4 ELISA Kit
ELI-14409r 96 Tests
EUR 886

RGS4 siRNA
20-abx904554
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS4 siRNA
20-abx931415
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS4 siRNA
20-abx931416
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RGS4 Antibody, HRP conjugated
1-CSB-PA019656LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RGS4 Antibody, FITC conjugated
1-CSB-PA019656LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RGS4 Antibody, Biotin conjugated
1-CSB-PA019656LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RGS4. Recognizes RGS4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RGS4 Blocking Peptide
33R-2276 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RGS4 antibody, catalog no. 70R-5834

RGS4 Blocking Peptide
DF9849-BP 1mg
EUR 195

RGS4 Blocking Peptide
20-abx064199
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RGS4 cloning plasmid
CSB-CL019656HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtgcaaagggcttgcaggtctgccggcttcttgcttgaggagtgcaaaagatatgaaacatcggctaggtttcctgctgcaaaaatctgattcctgtgaacacaattcttcccacaacaagaaggacaaagtggttatttgccagagagtgagccaagaggaagtcaagaaatg
  • Show more
Description: A cloning plasmid for the RGS4 gene.

pENTR223-RGS4 vector
PVT11964 2 ug
EUR 308

Anti-RGS4 (2B2)
YF-MA15189 100 ug
EUR 363
Description: Mouse monoclonal to RGS4

RGS4 protein (His tag)
80R-1921 50 ug
EUR 305
Description: Purified recombinant RGS4 protein

Human RGS4 ELISA Kit
EHR0046 96Tests
EUR 521

Bovine RGS4 ELISA Kit
EBR0046 96Tests
EUR 521

Anserini RGS4 ELISA Kit
EAR0046 96Tests
EUR 521

Chicken RGS4 ELISA Kit
ECKR0046 96Tests
EUR 521

Canine RGS4 ELISA Kit
ECR0046 96Tests
EUR 521

Goat RGS4 ELISA Kit
EGTR0046 96Tests
EUR 521

RGS4 ELISA KIT|Human
EF002439 96 Tests
EUR 689

Mouse RGS4 shRNA Plasmid
20-abx972453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RGS4 shRNA Plasmid
20-abx985529
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RGS4 shRNA Plasmid
20-abx954067
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine RGS4 ELISA Kit
EPR0046 96Tests
EUR 521

Sheep RGS4 ELISA Kit
ESR0046 96Tests
EUR 521

Rat RGS4 ELISA Kit
ERR0046 96Tests
EUR 521

Monkey RGS4 ELISA Kit
EMKR0046 96Tests
EUR 521

Mouse RGS4 ELISA Kit
EMR0046 96Tests
EUR 521

RGS4 Recombinant Protein (Human)
RP026335 100 ug Ask for price

RGS4 Recombinant Protein (Mouse)
RP167915 100 ug Ask for price

RGS4 Recombinant Protein (Rat)
RP225959 100 ug Ask for price

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human)
4-PAA978Hu01
  • EUR 232.00
  • EUR 2272.00
  • EUR 571.00
  • EUR 288.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4)

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), APC
4-PAA978Hu01-APC
  • EUR 323.00
  • EUR 2951.00
  • EUR 831.00
  • EUR 407.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with APC.

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), Biotinylated
4-PAA978Hu01-Biotin
  • EUR 295.00
  • EUR 2222.00
  • EUR 668.00
  • EUR 357.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with Biotin.

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), Cy3
4-PAA978Hu01-Cy3
  • EUR 389.00
  • EUR 3893.00
  • EUR 1067.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with Cy3.

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), FITC
4-PAA978Hu01-FITC
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with FITC.

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), HRP
4-PAA978Hu01-HRP
  • EUR 296.00
  • EUR 2574.00
  • EUR 737.00
  • EUR 369.00
  • EUR 198.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with HRP.

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), PE
4-PAA978Hu01-PE
  • EUR 278.00
  • EUR 2380.00
  • EUR 685.00
  • EUR 346.00
  • EUR 187.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with PE.

Monoclonal RGS4 Antibody (monoclonal) (M01), Clone: 2B2
AMM04008G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RGS4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B2. This antibody is applicable in WB, E

Rabbit Regulator of G- protein signaling 4, RGS4 ELISA KIT
ELI-45201Ra 96 Tests
EUR 928

Rabbit Regulator of G Protein Signaling 4 (RGS4) ELISA Kit
abx362774-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Guinea Pig RGS4 ELISA Kit
EGR0046 96Tests
EUR 521

Rgs4 ORF Vector (Rat) (pORF)
ORF075321 1.0 ug DNA
EUR 506

RGS4 ORF Vector (Human) (pORF)
ORF008779 1.0 ug DNA
EUR 95

Rgs4 ORF Vector (Mouse) (pORF)
ORF055973 1.0 ug DNA
EUR 506

RGS4 ELISA Kit (Human) (OKEH08721)
OKEH08721 96 Wells
EUR 896
Description: Description of target: Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 4 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. Regulator of G protein signaling 4 protein is 37% (n = 20) identical to RGS1 and 97% (n = 20) identical to rat Rgs4. This protein negatively regulate signaling upstream or at the level of the heterotrimeric G protein and is localized in the cytoplasm. Alternatively spliced transcript variants have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

RGS4 ELISA Kit (Human) (OKEI00172)
OKEI00172 96 Wells
EUR 767
Description: Description of target: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Activity on G(z)-alpha is inhibited by phosphorylation of the G-protein. Activity on G(z)-alpha and G(i)-alpha-1 is inhibited by palmitoylation of the G-protein. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

RGS4 ELISA Kit (Mouse) (OKEI00536)
OKEI00536 96 Wells
EUR 767
Description: Description of target: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Activity on G(z)-alpha is inhibited by phosphorylation of the G-protein. Activity on G(z)-alpha and G(i)-alpha-1 is inhibited by palmitoylation of the G-protein.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

RGS4 ELISA Kit (Rat) (OKEI00830)
OKEI00830 96 Wells
EUR 767
Description: Description of target: Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Activity on G(z)-alpha is inhibited by phosphorylation of the G-protein. Activity on G(z)-alpha and G(i)-alpha-1 is inhibited by palmitoylation of the G-protein. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Regulator Of G Protein Signaling 4 (RGS4) Polyclonal Antibody (Human), APC-Cy7
4-PAA978Hu01-APC-Cy7
  • EUR 526.00
  • EUR 5782.00
  • EUR 1543.00
  • EUR 695.00
  • EUR 299.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RGS4 (Ser38~Ala205)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Regulator Of G Protein Signaling 4 (RGS4). This antibody is labeled with APC-Cy7.

Regulator of G Protein Signaling 4 (RGS4) Antibody
20-abx007830
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 4 (RGS4) Antibody
20-abx103650
  • EUR 398.00
  • EUR 133.00
  • EUR 1094.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Regulator of G-Protein Signaling 4 (RGS4) Antibody
20-abx115114
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 4 (RGS4) Antibody
abx145580-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody
abx034141-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody
abx034141-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody
20-abx241269
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody
20-abx241270
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Regulator of G Protein Signaling 4 (RGS4) Antibody
abx237271-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody
20-abx301949
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rgs4 sgRNA CRISPR Lentivector set (Rat)
K6796601 3 x 1.0 ug
EUR 339

RGS4 sgRNA CRISPR Lentivector set (Human)
K1816901 3 x 1.0 ug
EUR 339

Rgs4 sgRNA CRISPR Lentivector set (Mouse)
K3800301 3 x 1.0 ug
EUR 339

Regulator Of G Protein Signaling 4 (RGS4) Antibody (HRP)
20-abx305119
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody (FITC)
20-abx305120
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Regulator Of G Protein Signaling 4 (RGS4) Antibody (Biotin)
20-abx305121
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rgs4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6796602 1.0 ug DNA
EUR 154

Rgs4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6796603 1.0 ug DNA
EUR 154

Rgs4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6796604 1.0 ug DNA
EUR 154

RGS4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1816902 1.0 ug DNA
EUR 154

RGS4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1816903 1.0 ug DNA
EUR 154

RGS4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1816904 1.0 ug DNA
EUR 154

Rgs4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3800302 1.0 ug DNA
EUR 154

RGS4 Rabbit Polyclonal Antibody