October 28, 2021

RAC2 Rabbit Polyclonal Antibody

RAC2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAC2 Polyclonal Antibody
ES10108-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
RAC2 Polyclonal Antibody
ABP60076-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RAC2 from Human, Mouse. This RAC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
RAC2 Polyclonal Antibody
ABP60076-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RAC2 from Human, Mouse. This RAC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
RAC2 Polyclonal Antibody
ABP60076-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of RAC2 from Human, Mouse. This RAC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
RAC2 Polyclonal Antibody
A63274 100 µg
EUR 570.55
Description: fast delivery possible
RAC2 Rabbit pAb
A0509-100ul 100 ul
EUR 308
RAC2 Rabbit pAb
A0509-200ul 200 ul
EUR 459
RAC2 Rabbit pAb
A0509-20ul 20 ul Ask for price
RAC2 Rabbit pAb
A0509-50ul 50 ul Ask for price
RAC2 Rabbit pAb
A1139-100ul 100 ul
EUR 308
RAC2 Rabbit pAb
A1139-200ul 200 ul
EUR 459
RAC2 Rabbit pAb
A1139-20ul 20 ul
EUR 183
RAC2 Rabbit pAb
A1139-50ul 50 ul
EUR 223
RAC2 antibody
70R-51321 100 ul
EUR 244
Description: Purified Polyclonal RAC2 antibody
RAC2 Antibody
ABD6273 100 ug
EUR 438
RAC2 antibody
38201-100ul 100ul
EUR 252
RAC2 Antibody
43907-100ul 100ul
EUR 252
Rac2 antibody
10R-6713 50 ul
EUR 208
Description: Mouse monoclonal Rac2 antibody
RAC2 antibody
70R-19739 50 ul
EUR 435
Description: Rabbit polyclonal RAC2 antibody
RAC2 Antibody
DF6273 200ul
EUR 304
Description: RAC2 Antibody detects endogenous levels of total RAC2.
RAC2 Antibody
1-CSB-PA019248GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
RAC2 Antibody
1-CSB-PA019248LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Polyclonal Goat Anti-RAC2 Antibody
APG00263G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAC2 . This antibody is tested and proven to work in the following applications:
RAC2 Polyclonal Antibody, HRP Conjugated
A63275 100 µg
EUR 570.55
Description: reagents widely cited
RAC2 Polyclonal Antibody, FITC Conjugated
A63276 100 µg
EUR 570.55
Description: Ask the seller for details
RAC2 Polyclonal Antibody, Biotin Conjugated
A63277 100 µg
EUR 570.55
Description: The best epigenetics products
Polyclonal Rac2 antibody - C-terminal region
AMM07506G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rac2 - C-terminal region. This antibody is tested and proven to work in the following applications:
RAC2 Conjugated Antibody
C38201 100ul
EUR 397
RAC2 Conjugated Antibody
C43907 100ul
EUR 397
anti- RAC2 antibody
FNab07067 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
  • Uniprot ID: P15153
  • Gene ID: 5880
  • Research Area: Signal Transduction
Description: Antibody raised against RAC2
anti- RAC2 antibody
FNab07068 100µg
EUR 585
  • Immunogen: ras-related C3 botulinum toxin substrate 2(rho family, small GTP binding protein Rac2)
  • Uniprot ID: P15153
  • Gene ID: 5880
  • Research Area: Signal Transduction
Description: Antibody raised against RAC2
anti- RAC2 antibody
FNab07069 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: ras-related C3 botulinum toxin substrate 2(rho family, small GTP binding protein Rac2)
  • Uniprot ID: P15153
  • Gene ID: 5880
  • Research Area: Signal Transduction
Description: Antibody raised against RAC2
Human RAC2 Antibody
32614-05111 150 ug
EUR 261
Anti-RAC2 antibody
PAab07067 100 ug
EUR 386
Anti-RAC2 antibody
PAab07068 100 ug
EUR 412
Anti-RAC2 antibody
STJ70120 100 µg
EUR 359
Anti-RAC2 antibody
STJ110976 100 µl
EUR 277
Description: This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6.
Anti-RAC2 antibody
STJ25274 100 µl
EUR 277
Description: This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6.
Anti-RAC2 antibody
STJ191266 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAC2
RAC2 siRNA
20-abx930749
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAC2 siRNA
20-abx930750
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-RAC2
YF-PA24537 50 ul
EUR 334
Description: Mouse polyclonal to RAC2
RAC2 Antibody, HRP conjugated
1-CSB-PA019248LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RAC2 Antibody, FITC conjugated
1-CSB-PA019248LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RAC2 Antibody, Biotin conjugated
1-CSB-PA019248LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-RAC1, RAC2 antibody
STJ13100299 100 µl
EUR 427
RAC2 cloning plasmid
CSB-CL019248HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 579
  • Sequence: atgcaggccatcaagtgtgtggtggtgggagatggggccgtgggcaagacctgccttctcatcagctacaccaccaacgcgtttcccggagagtacatccccaccgtgtttgacaactattcagccaatgtgatggtggacagcaagccagtgaacctggggctgtgggacactgc
  • Show more
Description: A cloning plasmid for the RAC2 gene.
RAC2 Blocking Peptide
20-abx064196
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
RAC2 Blocking Peptide
DF6273-BP 1mg
EUR 195
Rac2 Activation Assay
STA-401-2 20 assays
EUR 757
Description: Our Rac Activation Assays use visible agarose beads to selectively precipitate the active form of Rac1 or Rac2. The precipitated small GTPase is then detected by Western blot using a Rac1- or Rac2-specific antibody included in the kit.
Anti-RAC2 (M1)
YF-MA15089 200 ul
EUR 363
Description: Mouse monoclonal to RAC2
Anti-RAC2 (3B8)
YF-MA15090 100 ug
EUR 363
Description: Mouse monoclonal to RAC2
RAC1 / RAC2 / RAC3 / CDC42 Antibody
20-abx328546
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human RAC2 Antibody (Biotin Conjugate)
32614-05121 150 ug
EUR 369
RAC1/RAC2/RAC3/CDC42 Antibody
1-CSB-PA003908
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAC1/RAC2/RAC3/CDC42. Recognizes RAC1/RAC2/RAC3/CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
Human RAC2 AssayLite Antibody (FITC Conjugate)
32614-05141 150 ug
EUR 428
Human RAC2 AssayLite Antibody (RPE Conjugate)
32614-05151 150 ug
EUR 428
Human RAC2 AssayLite Antibody (APC Conjugate)
32614-05161 150 ug
EUR 428
Human RAC2 AssayLite Antibody (PerCP Conjugate)
32614-05171 150 ug
EUR 471
RAC2 ELISA KIT|Human
EF002277 96 Tests
EUR 689
Mouse Rac2 ELISA KIT
ELI-36027m 96 Tests
EUR 865
Bovine RAC2 ELISA KIT
ELI-36117b 96 Tests
EUR 928
Human RAC2 ELISA KIT
ELI-30393h 96 Tests
EUR 824
Human RAC2 shRNA Plasmid
20-abx953970
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RAC2 protein (His tag)
80R-1182 100 ug
EUR 305
Description: Purified recombinant Human RAC2 protein
Mouse RAC2 shRNA Plasmid
20-abx972357
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAC2 Rabbit Polyclonal Antibody