RAC2 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 RAC2 Polyclonal Antibody |
|
ES10108-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against RAC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
RAC2 Polyclonal Antibody |
|
ABP60076-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RAC2 from Human, Mouse. This RAC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210 |
|
RAC2 Polyclonal Antibody |
|
ABP60076-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RAC2 from Human, Mouse. This RAC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210 |
|
RAC2 Polyclonal Antibody |
|
ABP60076-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RAC2 from Human, Mouse. This RAC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAC2 protein at amino acid sequence of 130-210 |
|
RAC2 Polyclonal Antibody |
|
A63274 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 RAC2 Rabbit pAb |
|
A0509-100ul |
Abclonal |
100 ul |
EUR 308 |
|
RAC2 Rabbit pAb |
|
A0509-200ul |
Abclonal |
200 ul |
EUR 459 |
|
RAC2 Rabbit pAb |
|
A0509-20ul |
Abclonal |
20 ul |
Ask for price |
|
RAC2 Rabbit pAb |
|
A0509-50ul |
Abclonal |
50 ul |
Ask for price |
|
RAC2 Rabbit pAb |
|
A1139-100ul |
Abclonal |
100 ul |
EUR 308 |
|
RAC2 Rabbit pAb |
|
A1139-200ul |
Abclonal |
200 ul |
EUR 459 |
|
RAC2 Rabbit pAb |
|
A1139-20ul |
Abclonal |
20 ul |
EUR 183 |
|
RAC2 Rabbit pAb |
|
A1139-50ul |
Abclonal |
50 ul |
EUR 223 |
 RAC2 antibody |
|
70R-51321 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal RAC2 antibody |
|
RAC2 antibody |
|
38201-100ul |
SAB |
100ul |
EUR 252 |
 RAC2 Antibody |
|
43907-100ul |
SAB |
100ul |
EUR 252 |
 Rac2 antibody |
|
10R-6713 |
Fitzgerald |
50 ul |
EUR 208 |
|
Description: Mouse monoclonal Rac2 antibody |
|
RAC2 antibody |
|
70R-19739 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal RAC2 antibody |
|
RAC2 Antibody |
|
DF6273 |
Affbiotech |
200ul |
EUR 304 |
|
Description: RAC2 Antibody detects endogenous levels of total RAC2. |
|
RAC2 Antibody |
|
1-CSB-PA019248GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
|
RAC2 Antibody |
|
1-CSB-PA019248LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 Polyclonal Goat Anti-RAC2 Antibody |
|
APG00263G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAC2 . This antibody is tested and proven to work in the following applications: |
 RAC2 Polyclonal Antibody, HRP Conjugated |
|
A63275 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 RAC2 Polyclonal Antibody, FITC Conjugated |
|
A63276 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 RAC2 Polyclonal Antibody, Biotin Conjugated |
|
A63277 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Polyclonal Rac2 antibody - C-terminal region |
|
AMM07506G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rac2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 RAC2 Conjugated Antibody |
|
C38201 |
SAB |
100ul |
EUR 397 |
|
RAC2 Conjugated Antibody |
|
C43907 |
SAB |
100ul |
EUR 397 |
 anti- RAC2 antibody |
|
FNab07067 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
- Uniprot ID: P15153
- Gene ID: 5880
- Research Area: Signal Transduction
|
|
Description: Antibody raised against RAC2 |
|
anti- RAC2 antibody |
|
FNab07068 |
FN Test |
100µg |
EUR 585 |
- Immunogen: ras-related C3 botulinum toxin substrate 2(rho family, small GTP binding protein Rac2)
- Uniprot ID: P15153
- Gene ID: 5880
- Research Area: Signal Transduction
|
|
Description: Antibody raised against RAC2 |
|
anti- RAC2 antibody |
|
FNab07069 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:2000-1:10000
- IHC: 1:20-1:200
- Immunogen: ras-related C3 botulinum toxin substrate 2(rho family, small GTP binding protein Rac2)
- Uniprot ID: P15153
- Gene ID: 5880
- Research Area: Signal Transduction
|
|
Description: Antibody raised against RAC2 |
 Human RAC2 Antibody |
|
32614-05111 |
AssayPro |
150 ug |
EUR 261 |
 Anti-RAC2 antibody |
|
STJ110976 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. |
|
Anti-RAC2 antibody |
|
STJ25274 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. |
|
Anti-RAC2 antibody |
|
STJ191266 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RAC2 |
 RAC2 siRNA |
|
20-abx930749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
RAC2 siRNA |
|
20-abx930750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RAC2 |
|
YF-PA24537 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to RAC2 |
 RAC2 Antibody, HRP conjugated |
|
1-CSB-PA019248LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 RAC2 Antibody, FITC conjugated |
|
1-CSB-PA019248LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 RAC2 Antibody, Biotin conjugated |
|
1-CSB-PA019248LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against RAC2. Recognizes RAC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 RAC2 cloning plasmid |
|
CSB-CL019248HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 579
- Sequence: atgcaggccatcaagtgtgtggtggtgggagatggggccgtgggcaagacctgccttctcatcagctacaccaccaacgcgtttcccggagagtacatccccaccgtgtttgacaactattcagccaatgtgatggtggacagcaagccagtgaacctggggctgtgggacactgc
- Show more
|
|
Description: A cloning plasmid for the RAC2 gene. |
 RAC2 Blocking Peptide |
|
20-abx064196 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
RAC2 Blocking Peptide |
|
DF6273-BP |
Affbiotech |
1mg |
EUR 195 |
 Rac2 Activation Assay |
|
STA-401-2 |
Cell Biolabs |
20 assays |
EUR 757 |
|
Description: Our Rac Activation Assays use visible agarose beads to selectively precipitate the active form of Rac1 or Rac2. The precipitated small GTPase is then detected by Western blot using a Rac1- or Rac2-specific antibody included in the kit. |
) Anti-RAC2 (M1) |
|
YF-MA15089 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to RAC2 |
) Anti-RAC2 (3B8) |
|
YF-MA15090 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RAC2 |
 RAC1 / RAC2 / RAC3 / CDC42 Antibody |
|
20-abx328546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Human RAC2 Antibody (Biotin Conjugate) |
|
32614-05121 |
AssayPro |
150 ug |
EUR 369 |
 RAC1/RAC2/RAC3/CDC42 Antibody |
|
1-CSB-PA003908 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against RAC1/RAC2/RAC3/CDC42. Recognizes RAC1/RAC2/RAC3/CDC42 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
) Human RAC2 AssayLite Antibody (FITC Conjugate) |
|
32614-05141 |
AssayPro |
150 ug |
EUR 428 |
) Human RAC2 AssayLite Antibody (RPE Conjugate) |
|
32614-05151 |
AssayPro |
150 ug |
EUR 428 |
) Human RAC2 AssayLite Antibody (APC Conjugate) |
|
32614-05161 |
AssayPro |
150 ug |
EUR 428 |
) Human RAC2 AssayLite Antibody (PerCP Conjugate) |
|
32614-05171 |
AssayPro |
150 ug |
EUR 471 |
 Human RAC2 shRNA Plasmid |
|
20-abx953970 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) RAC2 protein (His tag) |
|
80R-1182 |
Fitzgerald |
100 ug |
EUR 305 |
|
Description: Purified recombinant Human RAC2 protein |
 Mouse RAC2 shRNA Plasmid |
|
20-abx972357 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RAC2 Rabbit Polyclonal Antibody
Anti-RAC1, RAC2 antibody 
RAC2 ELISA KIT|Human 
Mouse Rac2 ELISA KIT 
Bovine RAC2 ELISA KIT 
Human RAC2 ELISA KIT 