October 23, 2021

PEX13 Rabbit Polyclonal Antibody

PEX13 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PEX13 Polyclonal Antibody

ABP59880-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370

PEX13 Polyclonal Antibody

ABP59880-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370

PEX13 Polyclonal Antibody

A69111 100 ?g
EUR 628.55
Description: reagents widely cited

PEX13 antibody

70R-12990 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PEX13 antibody

PEX13 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

Polyclonal PEX13 Antibody (C-Term)

AMM07099G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PEX13 (C-Term). This antibody is tested and proven to work in the following applications:

PEX13 Polyclonal Antibody, HRP Conjugated

A69112 100 ?g
EUR 628.55
Description: Ask the seller for details

PEX13 Polyclonal Antibody, FITC Conjugated

A69113 100 ?g
EUR 628.55
Description: The best epigenetics products

PEX13 Polyclonal Antibody, Biotin Conjugated

A69114 100 ?g
EUR 628.55
Description: kits suitable for this type of research

Anti-PEX13 antibody

STJ70341 100 µg
EUR 359

Anti-PEX13 antibody

STJ191137 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PEX13


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PEX13 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PEX13 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PEX13 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Peroxisomal membrane protein PEX13, Pex13 ELISA KIT

ELI-16039m 96 Tests
EUR 865

Bovine Peroxisomal membrane protein PEX13, PEX13 ELISA KIT

ELI-37434b 96 Tests
EUR 928

Human Peroxisomal membrane protein PEX13, PEX13 ELISA KIT

ELI-43690h 96 Tests
EUR 824

PEX13 cloning plasmid

CSB-CL849799HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: atggcgtcccagccgccacctccccccaaaccctgggagacccgccgaattccgggagccggaccgggaccaggaccgggccccactttccaatctgctgatttgggtcctactttaatgacaagacctggacaaccagcacttaccagagtgcccccacctattcttccaaggc
  • Show more
Description: A cloning plasmid for the PEX13 gene.

Mouse PEX13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PEX13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PEX13 Recombinant Protein (Human)

RP023128 100 ug Ask for price

PEX13 Recombinant Protein (Rat)

RP220082 100 ug Ask for price

PEX13 Recombinant Protein (Mouse)

RP161381 100 ug Ask for price

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody

abx433119-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PEX13 ORF Vector (Human) (pORF)

ORF007710 1.0 ug DNA
EUR 95

Pex13 ORF Vector (Rat) (pORF)

ORF073362 1.0 ug DNA
EUR 506

Pex13 ORF Vector (Mouse) (pORF)

ORF053795 1.0 ug DNA
EUR 506

PEX13 sgRNA CRISPR Lentivector set (Human)

K1629601 3 x 1.0 ug
EUR 339

Pex13 sgRNA CRISPR Lentivector set (Mouse)

K4637501 3 x 1.0 ug
EUR 339

Pex13 sgRNA CRISPR Lentivector set (Rat)

K6176001 3 x 1.0 ug
EUR 339

PEX13 sgRNA CRISPR Lentivector (Human) (Target 1)

K1629602 1.0 ug DNA
EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 2)

K1629603 1.0 ug DNA
EUR 154

PEX13 sgRNA CRISPR Lentivector (Human) (Target 3)

K1629604 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4637502 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4637503 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4637504 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6176002 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6176003 1.0 ug DNA
EUR 154

Pex13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6176004 1.0 ug DNA
EUR 154

PEX13 Protein Vector (Human) (pPB-C-His)

PV030837 500 ng
EUR 329

PEX13 Protein Vector (Human) (pPB-N-His)

PV030838 500 ng
EUR 329

PEX13 Protein Vector (Human) (pPM-C-HA)

PV030839 500 ng
EUR 329

PEX13 Protein Vector (Human) (pPM-C-His)

PV030840 500 ng
EUR 329

PEX13 Protein Vector (Mouse) (pPB-C-His)

PV215178 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPB-N-His)

PV215179 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPM-C-HA)

PV215180 500 ng
EUR 603

PEX13 Protein Vector (Mouse) (pPM-C-His)

PV215181 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPB-C-His)

PV293446 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPB-N-His)

PV293447 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPM-C-HA)

PV293448 500 ng
EUR 603

PEX13 Protein Vector (Rat) (pPM-C-His)

PV293449 500 ng
EUR 603

Pex13 3'UTR GFP Stable Cell Line

TU166209 1.0 ml Ask for price

PEX13 3'UTR Luciferase Stable Cell Line

TU017754 1.0 ml
EUR 4617

Pex13 3'UTR Luciferase Stable Cell Line

TU116209 1.0 ml Ask for price

PEX13 3'UTR GFP Stable Cell Line

TU067754 1.0 ml
EUR 4617

Pex13 3'UTR GFP Stable Cell Line

TU266094 1.0 ml Ask for price

Pex13 3'UTR Luciferase Stable Cell Line

TU216094 1.0 ml Ask for price

Recombinant Pichia pastoris PEX13 Protein (aa 252-380)

VAng-Cr6649-1mgEcoli 1 mg (E. coli)
EUR 3514
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein.

Recombinant Pichia pastoris PEX13 Protein (aa 252-380)

VAng-Cr6649-500gEcoli 500 µg (E. coli)
EUR 2429
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein.

Recombinant Schizosaccharomyces Pombe pex13 Protein (aa 1-288)

VAng-Yyj5741-inquire inquire Ask for price
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Peroxisomal membrane protein pex13 (pex13), recombinant protein.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PEX13 Rabbit Polyclonal Antibody