October 23, 2021

RAB6B Rabbit Polyclonal Antibody

RAB6B Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB6B Polyclonal Antibody

ABP60070-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB6B protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB6B from Human, Mouse. This RAB6B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB6B protein at amino acid sequence of 80-160

RAB6B Polyclonal Antibody

A60506 100 µg
EUR 570.55
Description: Ask the seller for details

RAB6B Antibody

ABD9835 100 ug
EUR 438

RAB6B Antibody

46192-100ul 100ul
EUR 252

RAB6B Antibody

46192-50ul 50ul
EUR 187

Rab6B antibody

10R-2996 100 ug
EUR 282
Description: Rat monoclonal Rab6B antibody

RAB6B antibody

70R-19722 50 ul
EUR 435
Description: Rabbit polyclonal RAB6B antibody

RAB6B Antibody

DF9835 200ul
EUR 304
Description: RAB6B Antibody detects endogenous levels of total RAB6B.

RAB6B Antibody

1-CSB-PA873642LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

RAB6B Antibody

1-CSB-PA019217GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB6B Polyclonal Antibody, Biotin Conjugated

A60507 100 µg
EUR 570.55
Description: The best epigenetics products

RAB6B Polyclonal Antibody, FITC Conjugated

A60508 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAB6B Polyclonal Antibody, HRP Conjugated

A60509 100 µg
EUR 570.55
Description: fast delivery possible

RAB6B Conjugated Antibody

C46192 100ul
EUR 397

anti- RAB6B antibody

FNab07042 100µg
EUR 505.25
  • Immunogen: RAB6B, member RAS oncogene family
  • Uniprot ID: Q9NRW1
  • Gene ID: 51560
  • Research Area: Signal Transduction
Description: Antibody raised against RAB6B

RAB6B Antibody (HRP)

20-abx311243
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB6B Antibody (FITC)

20-abx311244
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB6B Antibody (Biotin)

20-abx311245
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RAB6B antibody

PAab07042 100 ug
EUR 355

Anti-RAB6B antibody

STJ13100309 100 µl
EUR 427

Anti-RAB6B antibody

STJ191290 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB6B

RAB6B siRNA

20-abx930701
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB6B siRNA

20-abx930702
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB6B Antibody, HRP conjugated

1-CSB-PA873642LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB6B Antibody, FITC conjugated

1-CSB-PA873642LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB6B Antibody, Biotin conjugated

1-CSB-PA873642LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB6B. Recognizes RAB6B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB6B cloning plasmid

CSB-CL873642HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atgtccgcagggggagattttgggaatccactgagaaaattcaagttggtgttcttgggggagcagagcgtcgggaagacgtctctgattacgaggttcatgtacgacagcttcgacaacacataccaggcaaccattgggattgacttcttgtcaaaaaccatgtacttggagga
  • Show more
Description: A cloning plasmid for the RAB6B gene.

RAB6B Blocking Peptide

DF9835-BP 1mg
EUR 195

Mouse RAB6B shRNA Plasmid

20-abx983106
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB6B ELISA KIT|Human

EF002257 96 Tests
EUR 689

Human RAB6B shRNA Plasmid

20-abx959832
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB6B protein (His tag)

80R-1676 100 ug
EUR 305
Description: Purified recombinant Human RAB6B protein

RAB6B Recombinant Protein (Human)

RP025540 100 ug Ask for price

RAB6B Recombinant Protein (Rat)

RP223382 100 ug Ask for price

RAB6B Recombinant Protein (Mouse)

RP166367 100 ug Ask for price

Ras-Related Protein Rab-6B (RAB6B) Antibody

20-abx115000
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

abx122951-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

abx027643-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

abx027643-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

20-abx218132
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (Rab6b) Antibody

abx224289-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

abx224411-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

20-abx318424
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-6B (RAB6B) Antibody

abx237042-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB6B ORF Vector (Human) (pORF)

ORF008514 1.0 ug DNA
EUR 95

Rab6b ORF Vector (Rat) (pORF)

ORF074462 1.0 ug DNA
EUR 506

Rab6b ORF Vector (Mouse) (pORF)

ORF055457 1.0 ug DNA
EUR 506

RAB6B, Member RAS Oncogene Family Protein

20-abx260859
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

RAB6B sgRNA CRISPR Lentivector set (Human)

K1769801 3 x 1.0 ug
EUR 339

Rab6b sgRNA CRISPR Lentivector set (Rat)

K6123201 3 x 1.0 ug
EUR 339

Rab6b sgRNA CRISPR Lentivector set (Mouse)

K4827101 3 x 1.0 ug
EUR 339

Recombinant Human RAB6B, Member RAS Oncogene Family

7-06001 5µg Ask for price

Recombinant Human RAB6B, Member RAS Oncogene Family

7-06002 20µg Ask for price

Recombinant Human RAB6B, Member RAS Oncogene Family

7-06003 1mg Ask for price

RAB6B sgRNA CRISPR Lentivector (Human) (Target 1)

K1769802 1.0 ug DNA
EUR 154

RAB6B sgRNA CRISPR Lentivector (Human) (Target 2)

K1769803 1.0 ug DNA
EUR 154

RAB6B sgRNA CRISPR Lentivector (Human) (Target 3)

K1769804 1.0 ug DNA
EUR 154

Rab6b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6123202 1.0 ug DNA
EUR 154

Rab6b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6123203 1.0 ug DNA
EUR 154

Rab6b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6123204 1.0 ug DNA
EUR 154

Rab6b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4827102 1.0 ug DNA
EUR 154

Rab6b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4827103 1.0 ug DNA
EUR 154

Rab6b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4827104 1.0 ug DNA
EUR 154

Recombinant Human RAB6B Protein, His, E.coli-1mg

QP13245-1mg 1mg
EUR 2757

Recombinant Human RAB6B Protein, His, E.coli-20ug

QP13245-20ug 20ug
EUR 201

Recombinant Human RAB6B Protein, His, E.coli-5ug

QP13245-5ug 5ug
EUR 155

RAB6B Protein Vector (Human) (pPB-C-His)

PV034053 500 ng
EUR 329

RAB6B Protein Vector (Human) (pPB-N-His)

PV034054 500 ng
EUR 329

RAB6B Protein Vector (Human) (pPM-C-HA)

PV034055 500 ng
EUR 329

RAB6B Protein Vector (Human) (pPM-C-His)

PV034056 500 ng
EUR 329

RAB6B Protein Vector (Rat) (pPB-C-His)

PV297846 500 ng
EUR 603

RAB6B Protein Vector (Rat) (pPB-N-His)

PV297847 500 ng
EUR 603

RAB6B Protein Vector (Rat) (pPM-C-HA)

PV297848 500 ng
EUR 603

RAB6B Protein Vector (Rat) (pPM-C-His)

PV297849 500 ng
EUR 603

RAB6B Protein Vector (Mouse) (pPB-C-His)

PV221826 500 ng
EUR 603

RAB6B Protein Vector (Mouse) (pPB-N-His)

PV221827 500 ng
EUR 603

RAB6B Protein Vector (Mouse) (pPM-C-HA)

PV221828 500 ng
EUR 603

RAB6B Protein Vector (Mouse) (pPM-C-His)

PV221829 500 ng
EUR 603

Rab6b 3'UTR GFP Stable Cell Line

TU167440 1.0 ml Ask for price

RAB6B 3'UTR Luciferase Stable Cell Line

TU019343 1.0 ml
EUR 2333

Rab6b 3'UTR Luciferase Stable Cell Line

TU117440 1.0 ml Ask for price

RAB6B 3'UTR GFP Stable Cell Line

TU069343 1.0 ml
EUR 2333

Rab6b 3'UTR GFP Stable Cell Line

TU267220 1.0 ml Ask for price

Rab6b 3'UTR Luciferase Stable Cell Line

TU217220 1.0 ml Ask for price

RAB6B, Member RAS Oncogene Family Human Recombinant Protein

PROTQ9NRW1 Regular: 20ug
EUR 317
Description: RAB6B Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 228 amino acids (1-208 a.a.) and having a molecular mass of 25.6kDa. The RAB6B is purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RAB6B Rabbit Polyclonal Antibody