CCL16 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 CCL16 Polyclonal Antibody |
|
ABP58012-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CCL16 from Human. This CCL16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90 |
|
CCL16 Polyclonal Antibody |
|
ABP58012-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CCL16 from Human. This CCL16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90 |
|
CCL16 Polyclonal Antibody |
|
ABP58012-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CCL16 from Human. This CCL16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90 |
|
CCL16 Polyclonal Antibody |
|
ES10265-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
CCL16 Polyclonal Antibody |
|
ES10265-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 CCL16 Rabbit pAb |
|
A15317-100ul |
Abclonal |
100 ul |
EUR 308 |
|
CCL16 Rabbit pAb |
|
A15317-200ul |
Abclonal |
200 ul |
EUR 459 |
|
CCL16 Rabbit pAb |
|
A15317-20ul |
Abclonal |
20 ul |
EUR 183 |
|
CCL16 Rabbit pAb |
|
A15317-50ul |
Abclonal |
50 ul |
EUR 223 |
 CCL16 antibody |
|
70R-10494 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal CCL16 antibody |
 CCL16 Antibody |
|
46941-100ul |
SAB |
100ul |
EUR 252 |
 CCL16 Antibody |
|
37464-100ul |
SAB |
100ul |
EUR 252 |
|
CCL16 Antibody |
|
1-CSB-PA08967A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
|
CCL16 Antibody |
|
1-CSB-PA940582 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
|
CCL16 Antibody |
|
DF9912 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CCL16 Antibody detects endogenous levels of total CCL16. |
|
CCL16 Antibody |
|
1-CSB-PA169235 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
|
CCL16 antibody |
|
70R-7847 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal CCL16 antibody |
 Rabbit CCL16 ELISA Kit |
|
ERTC0607 |
Abclonal |
96Tests |
EUR 521 |
 CCL16 Polyclonal Antibody, HRP Conjugated |
|
A55424 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 CCL16 Polyclonal Antibody, FITC Conjugated |
|
A55425 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 CCL16 Polyclonal Antibody, Biotin Conjugated |
|
A55426 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 Anti-CCL16 Antibody |
|
A07545-1 |
BosterBio |
100ug/vial |
EUR 294 |
 CCL16 Conjugated Antibody |
|
C37464 |
SAB |
100ul |
EUR 397 |
 CCL16 Conjugated Antibody |
|
C46941 |
SAB |
100ul |
EUR 397 |
 Anti-CCL16 antibody |
|
STJ117512 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for lymphocytes and monocytes but not for neutrophils. This cytokine also shows a potent myelosuppressive activity and suppresses proliferation of myeloid progenitor cells. The expression of this gene is upregulated by IL-10. |
|
Anti-CCL16 antibody |
|
STJ191423 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CCL16 |
 CCL16 protein |
|
30R-2577 |
Fitzgerald |
20 ug |
EUR 302 |
|
Description: Purified recombinant Human CCL16 protein |
 CCL16 siRNA |
|
20-abx910758 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CCL16 Antibody, HRP conjugated |
|
1-CSB-PA08967B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CCL16 Antibody, FITC conjugated |
|
1-CSB-PA08967C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CCL16 Antibody, Biotin conjugated |
|
1-CSB-PA08967D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 CCL16 Blocking Peptide |
|
33R-5134 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-10494 |
|
CCL16 Blocking Peptide |
|
33R-8609 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-7847 |
 CCL16, human recombinant |
|
4349-1000 |
Biovision |
|
EUR 4617 |
|
CCL16, human recombinant |
|
4349-20 |
Biovision |
|
EUR 256 |
|
CCL16 Blocking Peptide |
|
DF9912-BP |
Affbiotech |
1mg |
EUR 195 |
 CCL16 cloning plasmid |
|
CSB-CL004779HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 363
- Sequence: ATGAAGGTCTCCGAGGCTGCCCTGTCTCTCCTTGTCCTCATCCTTATCATTACTTCGGCTTCTCGCAGCCAGCCAAAAGTTCCTGAGTGGGTGAACACCCCATCCACCTGCTGCCTGAAGTATTATGAGAAAGTGTTGCCAAGGAGACTAGTGGTGGGATACAGAAAGGCCCTCAA
- Show more
|
|
Description: A cloning plasmid for the CCL16 gene. |
 Human CCL16 ELISA Kit |
|
EHC0607 |
Abclonal |
96Tests |
EUR 521 |
 Goat CCL16 ELISA Kit |
|
EGTC0607 |
Abclonal |
96Tests |
EUR 521 |
 Bovine CCL16 ELISA Kit |
|
EBC0607 |
Abclonal |
96Tests |
EUR 521 |
 Canine CCL16 ELISA Kit |
|
ECC0607 |
Abclonal |
96Tests |
EUR 521 |
 Anserini CCL16 ELISA Kit |
|
EAC0607 |
Abclonal |
96Tests |
EUR 521 |
 Human CCL16 shRNA Plasmid |
|
20-abx954293 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse CCL16 ELISA Kit |
|
EMC0607 |
Abclonal |
96Tests |
EUR 521 |
 Rat CCL16 ELISA Kit |
|
ERC0607 |
Abclonal |
96Tests |
EUR 521 |
 Porcine CCL16 ELISA Kit |
|
EPC0607 |
Abclonal |
96Tests |
EUR 521 |
 Polyclonal Antibody (Human)) Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human) |
|
4-PAB126Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CCL16 (Ala20~Gln120)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16) |
CCL16 Rabbit Polyclonal Antibody
Anti-LEC/CCL16/HCC4 antibody 
CCL16 ELISA KIT|Human 
HCC-4/CCL16, Human 