October 28, 2021

CCL16 Rabbit Polyclonal Antibody

CCL16 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

CCL16 Polyclonal Antibody
ABP58012-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CCL16 from Human. This CCL16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
CCL16 Polyclonal Antibody
ABP58012-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CCL16 from Human. This CCL16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
CCL16 Polyclonal Antibody
ABP58012-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CCL16 from Human. This CCL16 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL16 protein at amino acid sequence of 10-90
CCL16 Polyclonal Antibody
ES10265-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CCL16 Polyclonal Antibody
ES10265-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCL16 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CCL16 Rabbit pAb
A15317-100ul 100 ul
EUR 308
CCL16 Rabbit pAb
A15317-200ul 200 ul
EUR 459
CCL16 Rabbit pAb
A15317-20ul 20 ul
EUR 183
CCL16 Rabbit pAb
A15317-50ul 50 ul
EUR 223
CCL16 antibody
70R-10494 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL16 antibody
CCL16 Antibody
46941-100ul 100ul
EUR 252
CCL16 Antibody
37464-100ul 100ul
EUR 252
CCL16 Antibody
1-CSB-PA08967A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
CCL16 Antibody
1-CSB-PA940582
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
CCL16 Antibody
DF9912 200ul
EUR 304
Description: CCL16 Antibody detects endogenous levels of total CCL16.
CCL16 Antibody
1-CSB-PA169235
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
CCL16 antibody
70R-7847 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CCL16 antibody
CCL16 Antibody
ABD9912 100 ug
EUR 438
Rabbit CCL16 ELISA Kit
ERTC0607 96Tests
EUR 521
CCL16 Polyclonal Antibody, HRP Conjugated
A55424 100 µg
EUR 570.55
Description: Ask the seller for details
CCL16 Polyclonal Antibody, FITC Conjugated
A55425 100 µg
EUR 570.55
Description: The best epigenetics products
CCL16 Polyclonal Antibody, Biotin Conjugated
A55426 100 µg
EUR 570.55
Description: kits suitable for this type of research
Anti-CCL16 Antibody
A07545-1 100ug/vial
EUR 294
CCL16 Conjugated Antibody
C37464 100ul
EUR 397
CCL16 Conjugated Antibody
C46941 100ul
EUR 397
Anti-CCL16 antibody
STJ117512 100 µl
EUR 277
Description: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for lymphocytes and monocytes but not for neutrophils. This cytokine also shows a potent myelosuppressive activity and suppresses proliferation of myeloid progenitor cells. The expression of this gene is upregulated by IL-10.
Anti-CCL16 antibody
STJ191423 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCL16
CCL16 protein
30R-2577 20 ug
EUR 302
Description: Purified recombinant Human CCL16 protein
CCL16 siRNA
20-abx910758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CCL16 Antibody, HRP conjugated
1-CSB-PA08967B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CCL16 Antibody, FITC conjugated
1-CSB-PA08967C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CCL16 Antibody, Biotin conjugated
1-CSB-PA08967D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCL16. Recognizes CCL16 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CCL16 Blocking Peptide
33R-5134 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-10494
CCL16 Blocking Peptide
33R-8609 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCL16 antibody, catalog no. 70R-7847
CCL16, human recombinant
4349-1000
EUR 4617
CCL16, human recombinant
4349-20
EUR 256
CCL16 Blocking Peptide
DF9912-BP 1mg
EUR 195
CCL16 cloning plasmid
CSB-CL004779HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 363
  • Sequence: ATGAAGGTCTCCGAGGCTGCCCTGTCTCTCCTTGTCCTCATCCTTATCATTACTTCGGCTTCTCGCAGCCAGCCAAAAGTTCCTGAGTGGGTGAACACCCCATCCACCTGCTGCCTGAAGTATTATGAGAAAGTGTTGCCAAGGAGACTAGTGGTGGGATACAGAAAGGCCCTCAA
  • Show more
Description: A cloning plasmid for the CCL16 gene.
Anti-LEC/CCL16/HCC4 antibody
STJ16100997 100 µg
EUR 354
Human CCL16 ELISA Kit
ELA-E0138h 96 Tests
EUR 824
Human CCL16 ELISA Kit
EHC0607 96Tests
EUR 521
Goat CCL16 ELISA Kit
EGTC0607 96Tests
EUR 521
Bovine CCL16 ELISA Kit
EBC0607 96Tests
EUR 521
Canine CCL16 ELISA Kit
ECC0607 96Tests
EUR 521
Anserini CCL16 ELISA Kit
EAC0607 96Tests
EUR 521
CCL16 ELISA KIT|Human
EF000046 96 Tests
EUR 689
Human CCL16 shRNA Plasmid
20-abx954293
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HCC-4/CCL16, Human
HY-P7197 50ug
EUR 533
Mouse CCL16 ELISA Kit
EMC0607 96Tests
EUR 521
Rat CCL16 ELISA Kit
ERC0607 96Tests
EUR 521
Porcine CCL16 ELISA Kit
EPC0607 96Tests
EUR 521
Chemokine C-C-Motif Ligand 16 (CCL16) Polyclonal Antibody (Human)
4-PAB126Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CCL16 (Ala20~Gln120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chemokine C-C-Motif Ligand 16 (CCL16)

CCL16 Rabbit Polyclonal Antibody