October 17, 2021

PTPRK Rabbit Polyclonal Antibody

PTPRK Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PTPRK Polyclonal Antibody
ES10142-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTPRK from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PTPRK Polyclonal Antibody
ABP60040-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
PTPRK Polyclonal Antibody
ABP60040-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
PTPRK Polyclonal Antibody
ABP60040-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PTPRK from Human, Mouse. This PTPRK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTPRK protein at amino acid sequence of 180-260
PTPRK Rabbit pAb
A14773-100ul 100 ul
EUR 308
PTPRK Rabbit pAb
A14773-200ul 200 ul
EUR 459
PTPRK Rabbit pAb
A14773-20ul 20 ul
EUR 183
PTPRK Rabbit pAb
A14773-50ul 50 ul
EUR 223
PTPRK Antibody
ABD9842 100 ug
EUR 438
PTPRK Antibody
35901-100ul 100ul
EUR 252
PTPRK Antibody
DF9842 200ul
EUR 304
Description: PTPRK Antibody detects endogenous levels of total PTPRK.
PTPRK Antibody
1-CSB-PA613588LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
Rabbit PTPRK ELISA Kit
ERTP0176 96Tests
EUR 521
PTPRK Conjugated Antibody
C35901 100ul
EUR 397
Anti-PTPRK antibody
STJ116973 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation.
Anti-PTPRK antibody
STJ191300 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTPRK
PTPRK siRNA
20-abx930410
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTPRK siRNA
20-abx930411
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTPRK Antibody, HRP conjugated
1-CSB-PA613588LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PTPRK Antibody, FITC conjugated
1-CSB-PA613588LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PTPRK Antibody, Biotin conjugated
1-CSB-PA613588LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTPRK. Recognizes PTPRK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PTPRK cloning plasmid
CSB-CL613588HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 234
  • Sequence: atggatacgactgcggcggcggcgctgcctgcttttgtggcgctcttgctcctctctccttggcctctcctgggatcggcccaaggccagttctccgcagtgtctgtgcttgtggtcggtaacttttgctgctgttgttctgctgctgtctgccattccattcgccatctatcacg
  • Show more
Description: A cloning plasmid for the PTPRK gene.
PTPRK Blocking Peptide
DF9842-BP 1mg
EUR 195
Protein tyrosine phosphatase receptor type K (PTPRK) polyclonal antibody
ABP-PAB-11046 100 ug Ask for price
    • Product line: Phosphatases
    • Brand:
Human PTPRK ELISA Kit
EHP0176 96Tests
EUR 521
Goat PTPRK ELISA Kit
EGTP0176 96Tests
EUR 521
Bovine PTPRK ELISA Kit
EBP0176 96Tests
EUR 521
Anserini PTPRK ELISA Kit
EAP0176 96Tests
EUR 521
Canine PTPRK ELISA Kit
ECP0176 96Tests
EUR 521
Human PTPRK ELISA KIT
ELI-19769h 96 Tests
EUR 824
Mouse Ptprk ELISA KIT
ELI-22168m 96 Tests
EUR 865
PTPRK ELISA KIT|Human
EF005469 96 Tests
EUR 689
Porcine PTPRK ELISA Kit
EPP0176 96Tests
EUR 521
Rat PTPRK ELISA Kit
ERP0176 96Tests
EUR 521
Mouse PTPRK ELISA Kit
EMP0176 96Tests
EUR 521
Human PTPRK shRNA Plasmid
20-abx953918
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse PTPRK shRNA Plasmid
20-abx972307
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human)
4-PAB047Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK)
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), APC
4-PAB047Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with APC.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), Biotinylated
4-PAB047Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with Biotin.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), Cy3
4-PAB047Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with Cy3.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), FITC
4-PAB047Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with FITC.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), HRP
4-PAB047Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with HRP.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), PE
4-PAB047Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with PE.
Guinea Pig PTPRK ELISA Kit
EGP0176 96Tests
EUR 521
PTPRK ORF Vector (Human) (pORF)
ORF008412 1.0 ug DNA
EUR 95
Ptprk ORF Vector (Rat) (pORF)
ORF074333 1.0 ug DNA
EUR 2080
Ptprk ORF Vector (Mouse) (pORF)
ORF055248 1.0 ug DNA
EUR 1572
PTPRK ELISA Kit (Human) (OKEI00173)
OKEI00173 96 Wells
EUR 767
Description: Description of target: Regulation of processes involving cell contact and adhesion such as growth control, tumor invasion, and metastasis. Negative regulator of EGFR signaling pathway. Forms complexes with beta-catenin and gamma-catenin/plakoglobin. Beta-catenin may be a substrate for the catalytic activity of PTPRK/PTP-kappa.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
Rabbit Protein Tyrosine Phosphatase Receptor Type K (PTPRK) ELISA Kit
abx363755-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Polyclonal Antibody (Human), APC-Cy7
4-PAB047Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTPRK (Thr1185~Ser1440)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protein Tyrosine Phosphatase Receptor Type K (PTPRK). This antibody is labeled with APC-Cy7.
Protein Tyrosine Phosphatase Receptor Type K (PTPRK) Antibody
20-abx131546
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
PTPRK sgRNA CRISPR Lentivector set (Human)
K1758301 3 x 1.0 ug
EUR 339
Ptprk sgRNA CRISPR Lentivector set (Mouse)
K4506201 3 x 1.0 ug
EUR 339
Ptprk sgRNA CRISPR Lentivector set (Rat)
K7212301 3 x 1.0 ug
EUR 339
PTPRK sgRNA CRISPR Lentivector (Human) (Target 1)
K1758302 1.0 ug DNA
EUR 154
PTPRK sgRNA CRISPR Lentivector (Human) (Target 2)
K1758303 1.0 ug DNA
EUR 154
PTPRK sgRNA CRISPR Lentivector (Human) (Target 3)
K1758304 1.0 ug DNA
EUR 154
Ptprk sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4506202 1.0 ug DNA
EUR 154
Ptprk sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4506203 1.0 ug DNA
EUR 154
Ptprk sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4506204 1.0 ug DNA
EUR 154
Ptprk sgRNA CRISPR Lentivector (Rat) (Target 1)
K7212302 1.0 ug DNA
EUR 154
Ptprk sgRNA CRISPR Lentivector (Rat) (Target 2)
K7212303 1.0 ug DNA
EUR 154
Ptprk sgRNA CRISPR Lentivector (Rat) (Target 3)
K7212304 1.0 ug DNA
EUR 154
PTPRK Protein Vector (Human) (pPB-C-His)
PV033645 500 ng
EUR 329
PTPRK Protein Vector (Human) (pPB-N-His)
PV033646 500 ng
EUR 329
PTPRK Protein Vector (Human) (pPM-C-HA)
PV033647 500 ng
EUR 329
PTPRK Protein Vector (Human) (pPM-C-His)
PV033648 500 ng
EUR 329
PTPRK Protein Vector (Rat) (pPB-C-His)
PV297330 500 ng
EUR 2445
PTPRK Protein Vector (Rat) (pPB-N-His)
PV297331 500 ng
EUR 2445
PTPRK Protein Vector (Rat) (pPM-C-HA)
PV297332 500 ng
EUR 2445
PTPRK Protein Vector (Rat) (pPM-C-His)
PV297333 500 ng
EUR 2445
PTPRK Protein Vector (Mouse) (pPB-C-His)
PV220990 500 ng
EUR 2472
PTPRK Protein Vector (Mouse) (pPB-N-His)
PV220991 500 ng
EUR 2472
PTPRK Protein Vector (Mouse) (pPM-C-HA)
PV220992 500 ng
EUR 2472
PTPRK Protein Vector (Mouse) (pPM-C-His)
PV220993 500 ng
EUR 2472
Ptprk 3'UTR GFP Stable Cell Line
TU167295 1.0 ml Ask for price
PTPRK 3'UTR Luciferase Stable Cell Line
TU019228 1.0 ml
EUR 2333
Ptprk 3'UTR Luciferase Stable Cell Line
TU117295 1.0 ml Ask for price
PTPRK 3'UTR GFP Stable Cell Line
TU069228 1.0 ml
EUR 2333
Ptprk 3'UTR GFP Stable Cell Line
TU267088 1.0 ml Ask for price
Ptprk 3'UTR Luciferase Stable Cell Line
TU217088 1.0 ml Ask for price
PTPRK Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV689275 1.0 ug DNA
EUR 2286
PTPRK Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV689279 1.0 ug DNA
EUR 2286
PTPRK Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV689280 1.0 ug DNA
EUR 2286
Recombinant Protein Tyrosine Phosphatase Receptor Type K (PTPRK)
4-RPB047Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15262
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.3kDa
  • Isoelectric Point: 6
Description: Recombinant Human Protein Tyrosine Phosphatase Receptor Type K expressed in: E.coli
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PTPRK Rabbit Polyclonal Antibody