October 17, 2021

PHF6 Rabbit Polyclonal Antibody

PHF6 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PHF6 Polyclonal Antibody
ABP59897-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PHF6 from Human, Mouse. This PHF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370

PHF6 Polyclonal Antibody
ABP59897-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PHF6 from Human, Mouse. This PHF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370

PHF6 Polyclonal Antibody
ABP59897-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of PHF6 from Human, Mouse. This PHF6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PHF6 protein at amino acid sequence of 290-370

PHF6 Polyclonal Antibody
A-2743 100 µl
EUR 724.25
Description: Ask the seller for details

PHF6 Polyclonal Antibody
A57345 100 µg
EUR 570.55
Description: Ask the seller for details

PHF6 Rabbit pAb
A18149-100ul 100 ul
EUR 308

PHF6 Rabbit pAb
A18149-200ul 200 ul
EUR 459

PHF6 Rabbit pAb
A18149-20ul 20 ul
EUR 183

PHF6 Rabbit pAb
A18149-50ul 50 ul
EUR 223

PHF6 Rabbit pAb
A19486-100ul 100 ul Ask for price

PHF6 Rabbit pAb
A19486-200ul 200 ul Ask for price

PHF6 Rabbit pAb
A19486-20ul 20 ul Ask for price

PHF6 Rabbit pAb
A19486-50ul 50 ul
EUR 308

PHF6 Rabbit pAb
A7393-100ul 100 ul
EUR 308

PHF6 Rabbit pAb
A7393-200ul 200 ul
EUR 459

PHF6 Rabbit pAb
A7393-20ul 20 ul
EUR 183

PHF6 Rabbit pAb
A7393-50ul 50 ul
EUR 223

PHF6 antibody
70R-9074 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PHF6 antibody

PHF6 Antibody
35894-100ul 100ul
EUR 252

PHF6 antibody
20R-1278 100 ug
EUR 377
Description: Rabbit polyclonal PHF6 antibody

PHF6 antibody
20R-1279 100 ug
EUR 377
Description: Rabbit polyclonal PHF6 antibody

PHF6 antibody
70R-19258 50 ul
EUR 435
Description: Rabbit polyclonal PHF6 antibody

PHF6 Antibody
1-CSB-PA147848
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PHF6 Antibody
1-CSB-PA017917GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PHF6 Antibody
1-CSB-PA017917LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

PHF6 Polyclonal Antibody, HRP Conjugated
A57346 100 µg
EUR 570.55
Description: The best epigenetics products

PHF6 Polyclonal Antibody, FITC Conjugated
A57347 100 µg
EUR 570.55
Description: kits suitable for this type of research

PHF6 Polyclonal Antibody, Biotin Conjugated
A57348 100 µg
EUR 570.55
Description: fast delivery possible

PHF6
H-8098.0500 0.5mg
EUR 113
Description: Sum Formula: C36H60N8O9; CAS# [329897-62-3] net

PHF6
H-8098.1000 1.0mg
EUR 171
Description: Sum Formula: C36H60N8O9; CAS# [329897-62-3] net

PHF6 Conjugated Antibody
C35894 100ul
EUR 397

anti- PHF6 antibody
FNab06388 100µg
EUR 585
  • Immunogen: PHD finger protein 6
  • Uniprot ID: Q8IWS0
  • Gene ID: 84295
  • Research Area: Metabolism
Description: Antibody raised against PHF6

Anti-PHF6 antibody
PAab06388 100 ug
EUR 412

Anti-PHF6 antibody
STJ29530 100 µl
EUR 277
Description: This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms.

Anti-PHF6 antibody
STJ11100119 100 µl
EUR 277

Anti-PHF6 antibody
STJ11100679 50 µl
EUR 287
Description: This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms.

Anti-PHF6 antibody
STJ191144 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PHF6

PHF6 siRNA
20-abx928455
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHF6 siRNA
20-abx928456
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PHF6 Antibody, HRP conjugated
1-CSB-PA017917LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PHF6 Antibody, FITC conjugated
1-CSB-PA017917LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PHF6 Antibody, Biotin conjugated
1-CSB-PA017917LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PHF6. Recognizes PHF6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PHF6 cloning plasmid
CSB-CL017917HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 939
  • Sequence: atgtcaagctcagttgaacagaaaaaagggcctacaagacagcgcaaatgtggcttttgtaagtcaaatagagacaaggaatgtggacagttactaatatctgaaaaccagaaggtggcagcgcaccataagtgcatgctcttttcatctgctttggtatcatcacactctgataa
  • Show more
Description: A cloning plasmid for the PHF6 gene.

Acetyl-PHF6 amide
H-8112.0500 0.5mg
EUR 136
Description: Sum Formula: C38H63N9O9; CAS# [878663-43-5] net

Acetyl-PHF6 amide
H-8112.1000 1.0mg
EUR 194
Description: Sum Formula: C38H63N9O9; CAS# [878663-43-5] net

PHF6 Blocking Peptide
33R-4920 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF6 antibody, catalog no. 20R-1278

PHF6 Blocking Peptide
33R-1925 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF6 antibody, catalog no. 70R-9074

PHF6 Blocking Peptide
33R-9569 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PHF6 antibody, catalog no. 20R-1279

Mouse PHF6 shRNA Plasmid
20-abx977341
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PHF6 shRNA Plasmid
20-abx963418
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PHF6 ELISA KIT|Human
EF007338 96 Tests
EUR 689

Acetyl-PHF6 amide(TFA)
HY-P1675A 10mg
EUR 715

PHF6 Recombinant Protein (Human)
RP023338 100 ug Ask for price

PHF6 Recombinant Protein (Mouse)
RP161798 100 ug Ask for price

Phd Finger Protein 6 (PHF6) Antibody
20-abx114422
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody
20-abx142144
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody
20-abx006648
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody
20-abx004613
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody
abx236388-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

PHD Finger Protein 6 (PHF6) Antibody
20-abx302735
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHD finger protein 6 (PHF6) Antibody
20-abx212013
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody (HRP)
20-abx304819
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody (FITC)
20-abx304820
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHD Finger Protein 6 (PHF6) Antibody (Biotin)
20-abx304821
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PHF6 ORF Vector (Human) (pORF)
ORF007780 1.0 ug DNA
EUR 95

Phf6 ORF Vector (Mouse) (pORF)
ORF053934 1.0 ug DNA
EUR 506

PHF6 ELISA Kit (Human) (OKWB00198)
OKWB00198 96 Wells
EUR 572
Description: Description of target: Transcriptional regulator that associates with ribosomal RNA promoters and suppresses ribosomal RNA (rRNA) transcription.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL

PHF6 sgRNA CRISPR Lentivector set (Human)
K1639601 3 x 1.0 ug
EUR 339

Phf6 sgRNA CRISPR Lentivector set (Mouse)
K4704701 3 x 1.0 ug
EUR 339

PHF6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1639602 1.0 ug DNA
EUR 154

PHF6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1639603 1.0 ug DNA
EUR 154

PHF6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1639604 1.0 ug DNA
EUR 154

Phf6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4704702 1.0 ug DNA
EUR 154

Phf6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4704703 1.0 ug DNA
EUR 154

Phf6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4704704 1.0 ug DNA
EUR 154

PHF6 Protein Vector (Human) (pPB-C-His)
PV031117 500 ng
EUR 329

PHF6 Protein Vector (Human) (pPB-N-His)
PV031118 500 ng
EUR 329

PHF6 Protein Vector (Human) (pPM-C-HA)
PV031119 500 ng
EUR 329

PHF6 Protein Vector (Human) (pPM-C-His)
PV031120 500 ng
EUR 329

PHF6 Protein Vector (Mouse) (pPB-C-His)
PV215734 500 ng
EUR 603

PHF6 Protein Vector (Mouse) (pPB-N-His)
PV215735 500 ng
EUR 603

PHF6 Protein Vector (Mouse) (pPM-C-HA)
PV215736 500 ng
EUR 603

PHF6 Protein Vector (Mouse) (pPM-C-His)
PV215737 500 ng
EUR 603

Phf6 3'UTR GFP Stable Cell Line
TU166299 1.0 ml Ask for price

PHF6 3'UTR Luciferase Stable Cell Line
TU017855 1.0 ml
EUR 4617

Phf6 3'UTR Luciferase Stable Cell Line
TU116299 1.0 ml Ask for price

PHF6 3'UTR GFP Stable Cell Line
TU067855 1.0 ml
EUR 4617

Human PHF6(PHD finger protein 6) ELISA Kit
EH4132 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q8IWS0
  • Alias: PHD-like zinc finger protein/CENP-31/KIAA1823
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human PHD finger protein 6, PHF6 ELISA KIT
ELI-44987h 96 Tests
EUR 824

Mouse PHD finger protein 6, Phf6 ELISA KIT
ELI-45028m 96 Tests
EUR 865

Bovine PHD finger protein 6, PHF6 ELISA KIT
ELI-38008b 96 Tests
EUR 928

Human PHD finger protein 6 (PHF6) ELISA Kit
abx257269-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

PHF6 Rabbit Polyclonal Antibody