October 17, 2021

SYT15 Rabbit Polyclonal Antibody

SYT15 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SYT15 Polyclonal Antibody

ES10333-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT15 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Syt15/ Rat Syt15 ELISA Kit

ELI-52195r 96 Tests
EUR 886

Anti-SYT15 antibody

STJ191491 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT15

SYT15 siRNA

20-abx935847
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SYT15 siRNA

20-abx935848
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin-15 (SYT15) Antibody

abx145897-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

SYT15 cloning plasmid

CSB-CL874787HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: ATGGCGGAGCAGCTGGCCCTGGTGATTGGGGGCACCATCGGGGGGCTGCTGCTGCTGCTGTTGATCGGGGCAAGCTGCTGTCTGTGGAGAAGGTTCTGTGCCACCCTCACCTATGAGGAGCTGCCTGGGACACCAGCCATGGCCACCACAGCTGCCTCCAGTGGGCAGCGGGACA
  • Show more
Description: A cloning plasmid for the SYT15 gene.

Mouse SYT15 shRNA Plasmid

20-abx983276
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SYT15 shRNA Plasmid

20-abx963198
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT15 Recombinant Protein (Rat)

RP231977 100 ug Ask for price

SYT15 Recombinant Protein (Human)

RP043894 100 ug Ask for price

SYT15 Recombinant Protein (Mouse)

RP176867 100 ug Ask for price

SYT15 Recombinant Protein (Mouse)

RP176870 100 ug Ask for price

Syt15 ORF Vector (Rat) (pORF)

ORF077327 1.0 ug DNA
EUR 506

SYT15 ORF Vector (Human) (pORF)

ORF014632 1.0 ug DNA
EUR 354

Syt15 ORF Vector (Mouse) (pORF)

ORF058957 1.0 ug DNA
EUR 506

Syt15 ORF Vector (Mouse) (pORF)

ORF058958 1.0 ug DNA
EUR 506

Human Synaptotagmin XV (SYT15)ELISA Kit

201-12-2578 96 tests
EUR 440
  • This Synaptotagmin XV ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse Synaptotagmin- 15, Syt15 ELISA KIT

ELI-29938m 96 Tests
EUR 865

Human Synaptotagmin- 15, SYT15 ELISA KIT

ELI-41700h 96 Tests
EUR 824

Syt15 sgRNA CRISPR Lentivector set (Rat)

K7425301 3 x 1.0 ug
EUR 339

Syt15 sgRNA CRISPR Lentivector set (Mouse)

K3174501 3 x 1.0 ug
EUR 339

SYT15 sgRNA CRISPR Lentivector set (Human)

K2324001 3 x 1.0 ug
EUR 339

Human Synaptotagmin XV(SYT15)ELISA Kit

QY-E01183 96T
EUR 361

ELISA kit for Rat Synaptotagmin-15 (SYT15)

KTE100157-48T 48T
EUR 332
  • putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-15 (SYT15)

KTE100157-5platesof96wells 5 plates of 96 wells
EUR 2115
  • putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-15 (SYT15)

KTE100157-96T 96T
EUR 539
  • putative calcium-independent synaptotagmin protein that participates in membrane transport [RGD, Feb 2006]
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syt15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7425302 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7425303 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7425304 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3174502 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3174503 1.0 ug DNA
EUR 154

Syt15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3174504 1.0 ug DNA
EUR 154

SYT15 sgRNA CRISPR Lentivector (Human) (Target 1)

K2324002 1.0 ug DNA
EUR 154

SYT15 sgRNA CRISPR Lentivector (Human) (Target 2)

K2324003 1.0 ug DNA
EUR 154

SYT15 sgRNA CRISPR Lentivector (Human) (Target 3)

K2324004 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-15 (SYT15)

KTE60430-48T 48T
EUR 332
  • Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-15 (SYT15)

KTE60430-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-15 (SYT15)

KTE60430-96T 96T
EUR 539
  • Synaptotagmin-15 (Syt15) belongs to the synaptotagmin family, which is a group of membrane-trafficking proteins that contain two C-terminal C2 domains (known as C2A and C2B domains). Most of the synaptotagmins have a unique N-terminal domain that is
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-15 (SYT15)

KTE70300-48T 48T
EUR 332
  • SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-15 (SYT15)

KTE70300-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-15 (SYT15)

KTE70300-96T 96T
EUR 539
  • SYT15 encodes a member of the Synaptotagmin (Syt) family of membrane trafficking proteins. Members of this family contain a transmembrane region and a C-terminal-type tandem C2 domain. Unlike related family members, the encoded protein may be involve
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-15 (SYT15) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT15 Protein Vector (Rat) (pPB-C-His)

PV309306 500 ng
EUR 603

SYT15 Protein Vector (Rat) (pPB-N-His)

PV309307 500 ng
EUR 603

SYT15 Protein Vector (Rat) (pPM-C-HA)

PV309308 500 ng
EUR 603

SYT15 Protein Vector (Rat) (pPM-C-His)

PV309309 500 ng
EUR 603

SYT15 Protein Vector (Human) (pPB-C-His)

PV058525 500 ng
EUR 481

SYT15 Protein Vector (Human) (pPB-N-His)

PV058526 500 ng
EUR 481

SYT15 Protein Vector (Human) (pPM-C-HA)

PV058527 500 ng
EUR 481

SYT15 Protein Vector (Human) (pPM-C-His)

PV058528 500 ng
EUR 481

SYT15 Protein Vector (Mouse) (pPB-C-His)

PV235826 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-N-His)

PV235827 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-HA)

PV235828 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-His)

PV235829 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-C-His)

PV235830 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPB-N-His)

PV235831 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-HA)

PV235832 500 ng
EUR 603

SYT15 Protein Vector (Mouse) (pPM-C-His)

PV235833 500 ng
EUR 603

Syt15 3'UTR Luciferase Stable Cell Line

TU120041 1.0 ml Ask for price

Syt15 3'UTR GFP Stable Cell Line

TU170041 1.0 ml Ask for price

Syt15 3'UTR Luciferase Stable Cell Line

TU221486 1.0 ml Ask for price

SYT15 3'UTR GFP Stable Cell Line

TU075036 1.0 ml
EUR 2333

Syt15 3'UTR GFP Stable Cell Line

TU271486 1.0 ml Ask for price

SYT15 3'UTR Luciferase Stable Cell Line

TU025036 1.0 ml
EUR 2333

SYT15 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658495 1.0 ug DNA
EUR 682

SYT15 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658499 1.0 ug DNA
EUR 682

SYT15 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658500 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

SYT15 Rabbit Polyclonal Antibody