October 26, 2021

RRAGD Rabbit Polyclonal Antibody

RRAGD Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RRAGD Polyclonal Antibody

ABP60257-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RRAGD protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of RRAGD from Human, Mouse. This RRAGD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RRAGD protein at amino acid sequence of 140-220

RRAGD Rabbit pAb

A9979-100ul 100 ul
EUR 308

RRAGD Rabbit pAb

A9979-200ul 200 ul
EUR 459

RRAGD Rabbit pAb

A9979-20ul 20 ul
EUR 183

RRAGD Rabbit pAb

A9979-50ul 50 ul
EUR 223

Polyclonal RRAGD Antibody (Center)

AMM07666G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RRAGD (Center). This antibody is tested and proven to work in the following applications:

RRAGD Antibody

ABD9812 100 ug
EUR 438

RRAGD antibody

70R-3629 50 ug
EUR 467
Description: Rabbit polyclonal RRAGD antibody raised against the middle region of RRAGD

RRAGD Antibody

46175-100ul 100ul
EUR 252

RRAGD Antibody

46175-50ul 50ul
EUR 187

RRAGD Antibody

DF9812 200ul
EUR 304
Description: RRAGD Antibody detects endogenous levels of total RRAGD.

RRAGD Conjugated Antibody

C46175 100ul
EUR 397

Anti-RRAGD antibody

STJ112020 100 µl
EUR 277

Anti-RRAGD antibody

STJ191268 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RRAGD

RRAGD siRNA

20-abx932140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RRAGD siRNA

20-abx932141
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RRAGD

YF-PA20337 50 ug
EUR 363
Description: Mouse polyclonal to RRAGD

RRAGD Blocking Peptide

33R-1669 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RRAGD antibody, catalog no. 70R-3629

RRAGD Blocking Peptide

DF9812-BP 1mg
EUR 195

RRAGD cloning plasmid

CSB-CL889081HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 750
  • Sequence: atggaagccctggccaggctccacctcacggtgaccagggcctacaaagtgaatactgacatcaacttcgaggtgtttattcataaagtggatggtctgtcagatgaccacaaaattgaaacccaaagagatattcaccagagggcaaacgatgaccttgcagatgctggattaga
  • Show more
Description: A cloning plasmid for the RRAGD gene.

Mouse RRAGD shRNA Plasmid

20-abx974219
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RRAGD shRNA Plasmid

20-abx961747
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RRAGD Recombinant Protein (Human)

RP027274 100 ug Ask for price

RRAGD Recombinant Protein (Rat)

RP226937 100 ug Ask for price

RRAGD Recombinant Protein (Mouse)

RP169352 100 ug Ask for price

RRAGD ORF Vector (Human) (pORF)

ORF009092 1.0 ug DNA
EUR 95

Rragd ORF Vector (Mouse) (pORF)

ORF056452 1.0 ug DNA
EUR 506

Rragd ORF Vector (Rat) (pORF)

ORF075647 1.0 ug DNA
EUR 506

Ras-Related GTP-Binding Protein D (RRAGD) Antibody

20-abx135899
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related GTP-Binding Protein D (RRAGD) Antibody

abx032358-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras-Related GTP-Binding Protein D (RRAGD) Antibody

abx032358-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ras-Related GTP-Binding Protein D (RRAGD) Antibody

20-abx218391
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RRAGD sgRNA CRISPR Lentivector set (Human)

K2070401 3 x 1.0 ug
EUR 339

Rragd sgRNA CRISPR Lentivector set (Mouse)

K4895501 3 x 1.0 ug
EUR 339

Rragd sgRNA CRISPR Lentivector set (Rat)

K6707101 3 x 1.0 ug
EUR 339

RRAGD sgRNA CRISPR Lentivector (Human) (Target 1)

K2070402 1.0 ug DNA
EUR 154

RRAGD sgRNA CRISPR Lentivector (Human) (Target 2)

K2070403 1.0 ug DNA
EUR 154

RRAGD sgRNA CRISPR Lentivector (Human) (Target 3)

K2070404 1.0 ug DNA
EUR 154

Rragd sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4895502 1.0 ug DNA
EUR 154

Rragd sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4895503 1.0 ug DNA
EUR 154

Rragd sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4895504 1.0 ug DNA
EUR 154

Rragd sgRNA CRISPR Lentivector (Rat) (Target 1)

K6707102 1.0 ug DNA
EUR 154

Rragd sgRNA CRISPR Lentivector (Rat) (Target 2)

K6707103 1.0 ug DNA
EUR 154

Rragd sgRNA CRISPR Lentivector (Rat) (Target 3)

K6707104 1.0 ug DNA
EUR 154

RRAGD Protein Vector (Human) (pPB-C-His)

PV036365 500 ng
EUR 329

RRAGD Protein Vector (Human) (pPB-N-His)

PV036366 500 ng
EUR 329

RRAGD Protein Vector (Human) (pPM-C-HA)

PV036367 500 ng
EUR 329

RRAGD Protein Vector (Human) (pPM-C-His)

PV036368 500 ng
EUR 329

RRAGD Protein Vector (Rat) (pPB-C-His)

PV302586 500 ng
EUR 603

RRAGD Protein Vector (Rat) (pPB-N-His)

PV302587 500 ng
EUR 603

RRAGD Protein Vector (Rat) (pPM-C-HA)

PV302588 500 ng
EUR 603

RRAGD Protein Vector (Rat) (pPM-C-His)

PV302589 500 ng
EUR 603

RRAGD Protein Vector (Mouse) (pPB-C-His)

PV225806 500 ng
EUR 603

RRAGD Protein Vector (Mouse) (pPB-N-His)

PV225807 500 ng
EUR 603

RRAGD Protein Vector (Mouse) (pPM-C-HA)

PV225808 500 ng
EUR 603

RRAGD Protein Vector (Mouse) (pPM-C-His)

PV225809 500 ng
EUR 603

Rragd 3'UTR GFP Stable Cell Line

TU168187 1.0 ml Ask for price

RRAGD 3'UTR Luciferase Stable Cell Line

TU022385 1.0 ml
EUR 4617

Rragd 3'UTR Luciferase Stable Cell Line

TU118187 1.0 ml Ask for price

RRAGD 3'UTR GFP Stable Cell Line

TU072385 1.0 ml
EUR 4617

Rragd 3'UTR Luciferase Stable Cell Line

TU219729 1.0 ml Ask for price

Rragd 3'UTR GFP Stable Cell Line

TU269729 1.0 ml Ask for price

RRAGD Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV623413 1.0 ug DNA
EUR 682

RRAGD Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV623417 1.0 ug DNA
EUR 682

RRAGD Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV623418 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

RRAGD Rabbit Polyclonal Antibody