January 17, 2022

RAB32 Rabbit Polyclonal Antibody

RAB32 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB32 Polyclonal Antibody

ES10122-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB32 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB32 Polyclonal Antibody

ES10122-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB32 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB32 Rabbit pAb

A4470-100ul 100 ul
EUR 308

RAB32 Rabbit pAb

A4470-200ul 200 ul
EUR 459

RAB32 Rabbit pAb

A4470-20ul 20 ul Ask for price

RAB32 Rabbit pAb

A4470-50ul 50 ul Ask for price

RAB32 antibody

70R-19701 50 ul
EUR 435
Description: Rabbit polyclonal RAB32 antibody

RAB32 Antibody

46183-100ul 100ul
EUR 252

RAB32 Antibody

46183-50ul 50ul
EUR 187

RAB32 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB32. Recognizes RAB32 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RAB32 Antibody

DF9825 200ul
EUR 304
Description: RAB32 Antibody detects endogenous levels of total RAB32.

RAB32 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB32. Recognizes RAB32 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB32 Antibody

ABD9825 100 ug
EUR 438

Polyclonal RAB32 Antibody (N-term)

AMM07465G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB32 (N-term). This antibody is tested and proven to work in the following applications:

RAB32 Polyclonal Antibody, HRP Conjugated

A64731 100 µg
EUR 570.55
Description: The best epigenetics products

RAB32 Polyclonal Antibody, FITC Conjugated

A64732 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAB32 Polyclonal Antibody, Biotin Conjugated

A64733 100 µg
EUR 570.55
Description: fast delivery possible

RAB32, Member RAS Oncogene Family (RAB32) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody

abx029558-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody

abx029558-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody

abx237016-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human RAB32 Antibody

33298-05111 150 ug
EUR 261

RAB32 Conjugated Antibody

C46183 100ul
EUR 397

anti- RAB32 antibody

FNab07016 100µg
EUR 585
  • Immunogen: RAB32, member RAS oncogene family
  • Uniprot ID: Q13637
  • Gene ID: 10981
  • Research Area: Signal Transduction
Description: Antibody raised against RAB32

Anti-RAB32 antibody

PAab07016 100 ug
EUR 412

Anti-RAB32 antibody

STJ26685 100 µl
EUR 277
Description: The protein encoded by this gene anchors the type II regulatory subunit of protein kinase A to the mitochondrion and aids in mitochondrial fission. The encoded protein also appears to be involved in autophagy and melanosome secretion. Variations in this gene may be linked to leprosy.

Anti-Rab32 antibody

STJ140080 200 µg
EUR 231
Description: Goat polyclonal antibody to Rab32. Rab32 belongs to the small GTPase superfamily, Rab family. The protein is membranebound and involved in intracellular vesicle transport and small GTPase mediated signal transduction.

Anti-RAB32 antibody

STJ191280 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB32

RAB32, Member RAS Oncogene Family (RAB32) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB32, Member RAS Oncogene Family (RAB32) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17339 50 ul
EUR 363
Description: Mouse polyclonal to RAB32


YF-PA17340 50 ug
EUR 363
Description: Mouse polyclonal to RAB32


YF-PA17341 50 ul
EUR 363
Description: Mouse polyclonal to RAB32


YF-PA17342 50 ug
EUR 363
Description: Mouse polyclonal to RAB32


YF-PA17343 100 ul
EUR 403
Description: Rabbit polyclonal to RAB32


YF-PA17344 100 ug
EUR 403
Description: Rabbit polyclonal to RAB32


YF-PA25705 50 ul
EUR 334
Description: Mouse polyclonal to RAB32

RAB32 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB32. Recognizes RAB32 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB32 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB32. Recognizes RAB32 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB32 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB32. Recognizes RAB32 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB32 Blocking Peptide

DF9825-BP 1mg
EUR 195

RAB32 cloning plasmid

CSB-CL618795HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atggcgggcggaggagccggggaccccggcctgggggcggccgccgccccagcgcccgagacccgcgagcacctcttcaaggtgctggtgatcggcgagcttggcgtgggcaagaccagcatcatcaagcgctacgtccaccagctcttctcccagcactaccgggccaccatcgg
  • Show more
Description: A cloning plasmid for the RAB32 gene.

Anti-RAB32 (1C7)

YF-MA17548 100 ug
EUR 363
Description: Mouse monoclonal to RAB32

Human RAB32 Antibody (Biotin Conjugate)

33298-05121 150 ug
EUR 369

Human RAB32 AssayLite Antibody (FITC Conjugate)

33298-05141 150 ug
EUR 428

Human RAB32 AssayLite Antibody (RPE Conjugate)

33298-05151 150 ug
EUR 428

Human RAB32 AssayLite Antibody (APC Conjugate)

33298-05161 150 ug
EUR 428

Human RAB32 AssayLite Antibody (PerCP Conjugate)

33298-05171 150 ug
EUR 471

Rab32, Member Ras Oncogene Family Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB32 protein (His tag)

80R-2000 100 ug
EUR 322
Description: Recombinant human RAB32 protein (His tag)


EF002232 96 Tests
EUR 689

Mouse RAB32 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB32 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB32 Recombinant Protein (Human)

RP025474 100 ug Ask for price

RAB32 Recombinant Protein (Mouse)

RP166265 100 ug Ask for price

RAB32 Recombinant Protein (Rat)

RP223310 100 ug Ask for price

Rab32 ORF Vector (Rat) (pORF)

ORF074438 1.0 ug DNA
EUR 506

RAB32 ORF Vector (Human) (pORF)

ORF008492 1.0 ug DNA
EUR 95

Rab32 ORF Vector (Mouse) (pORF)

ORF055423 1.0 ug DNA
EUR 506

RAB32, Member RAS Oncogene Family Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Rab32 sgRNA CRISPR Lentivector set (Rat)

K6446301 3 x 1.0 ug
EUR 339

Rab32 sgRNA CRISPR Lentivector set (Mouse)

K3552901 3 x 1.0 ug
EUR 339

RAB32 sgRNA CRISPR Lentivector set (Human)

K1773401 3 x 1.0 ug
EUR 339

Rab32 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6446302 1.0 ug DNA
EUR 154

Rab32 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6446303 1.0 ug DNA
EUR 154

Rab32 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6446304 1.0 ug DNA
EUR 154

Rab32 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3552902 1.0 ug DNA
EUR 154

Rab32 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3552903 1.0 ug DNA
EUR 154

Rab32 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3552904 1.0 ug DNA
EUR 154

RAB32 sgRNA CRISPR Lentivector (Human) (Target 1)

K1773402 1.0 ug DNA
EUR 154

RAB32 sgRNA CRISPR Lentivector (Human) (Target 2)

K1773403 1.0 ug DNA
EUR 154

RAB32 sgRNA CRISPR Lentivector (Human) (Target 3)

K1773404 1.0 ug DNA
EUR 154

RAB32 3'UTR Luciferase Stable Cell Line

TU019385 1.0 ml
EUR 1394

Rab32 3'UTR Luciferase Stable Cell Line

TU117411 1.0 ml Ask for price

Rab32 3'UTR GFP Stable Cell Line

TU167411 1.0 ml Ask for price

RAB32 Rabbit Polyclonal Antibody