October 17, 2021

NDE1 Rabbit Polyclonal Antibody

NDE1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NDE1 Polyclonal Antibody
ES9931-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NDE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
NDE1 Polyclonal Antibody
ABP59414-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDE1 from Human, Mouse, Rat. This NDE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
NDE1 Polyclonal Antibody
ABP59414-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDE1 from Human, Mouse, Rat. This NDE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
NDE1 Polyclonal Antibody
ABP59414-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of NDE1 from Human, Mouse, Rat. This NDE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDE1 protein at amino acid sequence of 270-350
NDE1 Polyclonal Antibody
30827-100ul 100ul
EUR 252
NDE1 Polyclonal Antibody
30827-50ul 50ul
EUR 187
NDE1 Polyclonal Antibody
28440-100ul 100ul
EUR 252
NDE1 Polyclonal Antibody
28440-50ul 50ul
EUR 187
NDE1 Rabbit pAb
A7112-100ul 100 ul
EUR 308
NDE1 Rabbit pAb
A7112-200ul 200 ul
EUR 459
NDE1 Rabbit pAb
A7112-20ul 20 ul
EUR 183
NDE1 Rabbit pAb
A7112-50ul 50 ul
EUR 223
NDE1 Rabbit pAb
A14136-100ul 100 ul
EUR 308
NDE1 Rabbit pAb
A14136-200ul 200 ul
EUR 459
NDE1 Rabbit pAb
A14136-20ul 20 ul
EUR 183
NDE1 Rabbit pAb
A14136-50ul 50 ul
EUR 223
NDE1 Polyclonal Conjugated Antibody
C30827 100ul
EUR 397
NDE1 Polyclonal Conjugated Antibody
C28440 100ul
EUR 397
NDE1 antibody
70R-2212 50 ug
EUR 467
Description: Rabbit polyclonal NDE1 antibody
NDE1 antibody
10R-7815 50 ul
EUR 208
Description: Mouse monoclonal NDE1 antibody
NDE1 antibody
70R-18792 50 ul
EUR 435
Description: Rabbit polyclonal NDE1 antibody
NDE1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NDE1. Recognizes NDE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
NDE1 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NDE1. Recognizes NDE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
NDE1 Antibody
DF12040 200ul
EUR 304
Description: NDE1 antibody detects endogenous levels of NDE1.
NDE1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NDE1. Recognizes NDE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
Nde1/ Rat Nde1 ELISA Kit
ELI-46034r 96 Tests
EUR 886
anti- NDE1 antibody
FNab05600 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: nudE nuclear distribution gene E homolog 1 (A. nidulans)
  • Uniprot ID: Q9NXR1
  • Gene ID: 54820
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against NDE1
Anti-NDE1 antibody
PAab05600 100 ug
EUR 355
Anti-NDE1 antibody
STJ29192 100 µl
EUR 277
Description: This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe mental retardation. Alternative splicing results in multiple transcript variants.
Anti-NDE1 antibody
STJ191089 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NDE1
Anti-NDE1 antibody
STJ116071 100 µl
EUR 277
Description: This gene encodes a member of the nuclear distribution E (NudE) family of proteins. The encoded protein is localized at the centrosome and interacts with other centrosome components as part of a multiprotein complex that regulates dynein function. This protein plays an essential role in microtubule organization, mitosis and neuronal migration. Mutations in this gene cause lissencephaly 4, a disorder characterized by lissencephaly, severe brain atrophy, microcephaly, and severe mental retardation. Alternative splicing results in multiple transcript variants.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NDE1 Blocking Peptide
33R-1254 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EBF3 antibody, catalog no. 20R-1069
NDE1 Blocking Peptide
DF12040-BP 1mg
EUR 195
NDE1 cloning plasmid
CSB-CL889142HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaggactccggaaagactttcagctccgaggaggaagaagctaactattggaaagatctggcgatgacctacaaacagagggcagaaaatacgcaagaggaactccgagaattccaggagggaagccgagaatatgaagctgaattggagacgcagctgcaacaaattgaaa
  • Show more
Description: A cloning plasmid for the NDE1 gene.
Mouse NDE1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat NDE1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-22196c 96 Tests
EUR 928
Mouse Nde1 ELISA KIT
ELI-16436m 96 Tests
EUR 865
EF001122 96 Tests
EUR 689
ELI-38372h 96 Tests
EUR 824
NDE1 protein (His tag)
80R-1784 100 ug
EUR 305
Description: Purified recombinant Human NDE1 protein
Human NDE1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NDE1 Recombinant Protein (Human)
RP020878 100 ug Ask for price
NDE1 Recombinant Protein (Rat)
RP213440 100 ug Ask for price
NDE1 Recombinant Protein (Mouse)
RP153365 100 ug Ask for price
NDE1 Recombinant Protein (Mouse)
RP153368 100 ug Ask for price
Anti-NDE1 (2G11-1C11)
YF-MA18693 100 ug
EUR 363
Description: Mouse monoclonal to NDE1
NudE Neurodevelopment Protein 1 (NDE1) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
NudE Neurodevelopment Protein 1 (NDE1) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
NudE Neurodevelopment Protein 1 (NDE1) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
NudE Neurodevelopment Protein 1 (NDE1) Antibody
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
NudE Neurodevelopment Protein 1 (NDE1) Antibody
abx235600-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
NDE1 ORF Vector (Human) (pORF)
ORF006960 1.0 ug DNA
EUR 95
Nde1 ORF Vector (Rat) (pORF)
ORF071148 1.0 ug DNA
EUR 506
Nde1 ORF Vector (Mouse) (pORF)
ORF051123 1.0 ug DNA
EUR 506
Nde1 ORF Vector (Mouse) (pORF)
ORF051124 1.0 ug DNA
EUR 506
Monoclonal NDE1 Antibody (monoclonal) (M01), Clone: 2G11-1C11
AMM06577G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NDE1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G11-1C11. This antibody is applicable in WB and IF, E
NudE Neurodevelopment Protein 1 (NDE1) Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

NDE1 Rabbit Polyclonal Antibody