October 23, 2021

RIN2 Rabbit Polyclonal Antibody

RIN2 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RIN2 Polyclonal Antibody

ABP60176-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of RIN2 from Human, Mouse. This RIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150

RIN2 Polyclonal Antibody

ABP60176-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of RIN2 from Human, Mouse. This RIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150

RIN2 Polyclonal Antibody

ABP60176-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of RIN2 from Human, Mouse. This RIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150

RIN2 Polyclonal Antibody

28354-100ul 100ul
EUR 252

RIN2 Polyclonal Antibody

28354-50ul 50ul
EUR 187

RIN2 Rabbit pAb

A13798-100ul 100 ul
EUR 308

RIN2 Rabbit pAb

A13798-200ul 200 ul
EUR 459

RIN2 Rabbit pAb

A13798-20ul 20 ul
EUR 183

RIN2 Rabbit pAb

A13798-50ul 50 ul
EUR 223

RIN2 Polyclonal Conjugated Antibody

C28354 100ul
EUR 397

RIN2 Antibody

abx145081-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Anti-RIN2 antibody

STJ191255 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RIN2

Anti-RIN2 antibody

STJ115742 100 µl
EUR 277
Description: The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants.

RIN2 siRNA

20-abx931546
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RIN2 siRNA

20-abx931547
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RIN2

YF-PA26253 50 ul
EUR 334
Description: Mouse polyclonal to RIN2

RIN2 cloning plasmid

CSB-CL019727HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: ATGACAGCTTGGACCATGGGCGCCCGCGGTCTGGACAAGCGAGGAAGTTTCTTTAAGCTCATTGACACAATTGCCTCGGAGATCGGAGAACTGAAACAGGAGATGGTGCGGACAGATGTCAACCTGGAAAATGGCCTGGAACCCGCTGAAACCCACAGCATGGTAAGACACAAGG
  • Show more
Description: A cloning plasmid for the RIN2 gene.

Anti-RIN2 (1E6)

YF-MA18645 100 ug
EUR 363
Description: Mouse monoclonal to RIN2

Anti-RIN2 (1E7)

YF-MA11541 100 ug
EUR 363
Description: Mouse monoclonal to RIN2

Replacement sealing ring

B3000-RIN2 1 PC
EUR 73.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Mouse RIN2 shRNA Plasmid

20-abx978064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RIN2 shRNA Plasmid

20-abx960061
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal RIN2 Antibody (monoclonal) (M01), Clone: 1E8

AMM07627G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E8. This antibody is applicable in WB and IHC, E

Monoclonal RIN2 Antibody (monoclonal) (M04), Clone: 1E7

AMM07628G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human RIN2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 1E7. This antibody is applicable in WB, E

Rin2 ORF Vector (Mouse) (pORF)

ORF056085 1.0 ug DNA
EUR 506

Rin2 ORF Vector (Rat) (pORF)

ORF075385 1.0 ug DNA
EUR 506

RIN2 ORF Vector (Human) (pORF)

ORF014301 1.0 ug DNA
EUR 354

RIN2 sgRNA CRISPR Lentivector set (Human)

K1825001 3 x 1.0 ug
EUR 339

Rin2 sgRNA CRISPR Lentivector set (Mouse)

K3515001 3 x 1.0 ug
EUR 339

Rin2 sgRNA CRISPR Lentivector set (Rat)

K6397601 3 x 1.0 ug
EUR 339

RIN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1825002 1.0 ug DNA
EUR 154

RIN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1825003 1.0 ug DNA
EUR 154

RIN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1825004 1.0 ug DNA
EUR 154

Rin2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3515002 1.0 ug DNA
EUR 154

Rin2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3515003 1.0 ug DNA
EUR 154

Rin2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3515004 1.0 ug DNA
EUR 154

Rin2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6397602 1.0 ug DNA
EUR 154

Rin2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6397603 1.0 ug DNA
EUR 154

Rin2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6397604 1.0 ug DNA
EUR 154

RIN2 Protein Vector (Human) (pPB-C-His)

PV057201 500 ng
EUR 481

RIN2 Protein Vector (Human) (pPB-N-His)

PV057202 500 ng
EUR 481

RIN2 Protein Vector (Human) (pPM-C-HA)

PV057203 500 ng
EUR 481

RIN2 Protein Vector (Human) (pPM-C-His)

PV057204 500 ng
EUR 481

RIN2 Protein Vector (Rat) (pPB-C-His)

PV301538 500 ng
EUR 1191

RIN2 Protein Vector (Rat) (pPB-N-His)

PV301539 500 ng
EUR 1191

RIN2 Protein Vector (Rat) (pPM-C-HA)

PV301540 500 ng
EUR 1191

RIN2 Protein Vector (Rat) (pPM-C-His)

PV301541 500 ng
EUR 1191

RIN2 Protein Vector (Mouse) (pPB-C-His)

PV224338 500 ng
EUR 1065

RIN2 Protein Vector (Mouse) (pPB-N-His)

PV224339 500 ng
EUR 1065

RIN2 Protein Vector (Mouse) (pPM-C-HA)

PV224340 500 ng
EUR 1065

RIN2 Protein Vector (Mouse) (pPM-C-His)

PV224341 500 ng
EUR 1065

Rin2 3'UTR GFP Stable Cell Line

TU167895 1.0 ml Ask for price

RIN2 3'UTR Luciferase Stable Cell Line

TU019928 1.0 ml
EUR 1521

Rin2 3'UTR Luciferase Stable Cell Line

TU117895 1.0 ml Ask for price

RIN2 3'UTR GFP Stable Cell Line

TU069928 1.0 ml
EUR 1521

RIN2 Rabbit Polyclonal Antibody