RIN2 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 RIN2 Polyclonal Antibody |
|
ABP60176-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RIN2 from Human, Mouse. This RIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150 |
RIN2 Polyclonal Antibody |
|
ABP60176-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RIN2 from Human, Mouse. This RIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150 |
RIN2 Polyclonal Antibody |
|
ABP60176-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of RIN2 from Human, Mouse. This RIN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIN2 protein at amino acid sequence of 70-150 |
RIN2 Polyclonal Antibody |
|
28354-100ul |
SAB |
100ul |
EUR 252 |
RIN2 Polyclonal Antibody |
|
28354-50ul |
SAB |
50ul |
EUR 187 |
 RIN2 Rabbit pAb |
|
A13798-100ul |
Abclonal |
100 ul |
EUR 308 |
RIN2 Rabbit pAb |
|
A13798-200ul |
Abclonal |
200 ul |
EUR 459 |
RIN2 Rabbit pAb |
|
A13798-20ul |
Abclonal |
20 ul |
EUR 183 |
RIN2 Rabbit pAb |
|
A13798-50ul |
Abclonal |
50 ul |
EUR 223 |
 RIN2 Polyclonal Conjugated Antibody |
|
C28354 |
SAB |
100ul |
EUR 397 |
 RIN2 Antibody |
|
abx145081-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
 Anti-RIN2 antibody |
|
STJ191255 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to RIN2 |
Anti-RIN2 antibody |
|
STJ115742 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. |
 RIN2 siRNA |
|
20-abx931546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIN2 siRNA |
|
20-abx931547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-RIN2 |
|
YF-PA26253 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to RIN2 |
 RIN2 cloning plasmid |
|
CSB-CL019727HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1389
- Sequence: ATGACAGCTTGGACCATGGGCGCCCGCGGTCTGGACAAGCGAGGAAGTTTCTTTAAGCTCATTGACACAATTGCCTCGGAGATCGGAGAACTGAAACAGGAGATGGTGCGGACAGATGTCAACCTGGAAAATGGCCTGGAACCCGCTGAAACCCACAGCATGGTAAGACACAAGG
- Show more
|
|
Description: A cloning plasmid for the RIN2 gene. |
) Anti-RIN2 (1E6) |
|
YF-MA18645 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RIN2 |
) Anti-RIN2 (1E7) |
|
YF-MA11541 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to RIN2 |
 Replacement sealing ring |
|
B3000-RIN2 |
BenchMark |
1 PC |
EUR 73.77 |
- To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
|
 Mouse RIN2 shRNA Plasmid |
|
20-abx978064 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human RIN2 shRNA Plasmid |
|
20-abx960061 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (M01), Clone: 1E8) Monoclonal RIN2 Antibody (monoclonal) (M01), Clone: 1E8 |
|
AMM07627G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human RIN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1E8. This antibody is applicable in WB and IHC, E |
 (M04), Clone: 1E7) Monoclonal RIN2 Antibody (monoclonal) (M04), Clone: 1E7 |
|
AMM07628G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human RIN2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 1E7. This antibody is applicable in WB, E |
 (pORF)) Rin2 ORF Vector (Mouse) (pORF) |
|
ORF056085 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Rin2 ORF Vector (Rat) (pORF) |
|
ORF075385 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) RIN2 ORF Vector (Human) (pORF) |
|
ORF014301 |
ABM |
1.0 ug DNA |
EUR 354 |
) RIN2 sgRNA CRISPR Lentivector set (Human) |
|
K1825001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rin2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3515001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Rin2 sgRNA CRISPR Lentivector set (Rat) |
|
K6397601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) RIN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1825002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) RIN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1825003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) RIN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1825004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rin2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3515002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rin2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3515003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rin2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3515004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Rin2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6397602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Rin2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6397603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Rin2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6397604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) RIN2 Protein Vector (Human) (pPB-C-His) |
|
PV057201 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) RIN2 Protein Vector (Human) (pPB-N-His) |
|
PV057202 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) RIN2 Protein Vector (Human) (pPM-C-HA) |
|
PV057203 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) RIN2 Protein Vector (Human) (pPM-C-His) |
|
PV057204 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) RIN2 Protein Vector (Rat) (pPB-C-His) |
|
PV301538 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) RIN2 Protein Vector (Rat) (pPB-N-His) |
|
PV301539 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) RIN2 Protein Vector (Rat) (pPM-C-HA) |
|
PV301540 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) RIN2 Protein Vector (Rat) (pPM-C-His) |
|
PV301541 |
ABM |
500 ng |
EUR 1191 |
 (pPB-C-His)) RIN2 Protein Vector (Mouse) (pPB-C-His) |
|
PV224338 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) RIN2 Protein Vector (Mouse) (pPB-N-His) |
|
PV224339 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) RIN2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV224340 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) RIN2 Protein Vector (Mouse) (pPM-C-His) |
|
PV224341 |
ABM |
500 ng |
EUR 1065 |
 Rin2 3'UTR GFP Stable Cell Line |
|
TU167895 |
ABM |
1.0 ml |
Ask for price |
 RIN2 3'UTR Luciferase Stable Cell Line |
|
TU019928 |
ABM |
1.0 ml |
EUR 1521 |
 Rin2 3'UTR Luciferase Stable Cell Line |
|
TU117895 |
ABM |
1.0 ml |
Ask for price |
 RIN2 3'UTR GFP Stable Cell Line |
|
TU069928 |
ABM |
1.0 ml |
EUR 1521 |
RIN2 Rabbit Polyclonal Antibody
