October 17, 2021

NSUN5 Rabbit Polyclonal Antibody

NSUN5 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NSUN5 Polyclonal Antibody
ES10073-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NSUN5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
NSUN5 Polyclonal Antibody
ABP59543-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NSUN5 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of NSUN5 from Human, Mouse. This NSUN5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NSUN5 protein at amino acid sequence of 320-400
NSUN5 Polyclonal Antibody
ABP59543-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NSUN5 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of NSUN5 from Human, Mouse. This NSUN5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NSUN5 protein at amino acid sequence of 320-400
NSUN5 Polyclonal Antibody
ABP59543-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NSUN5 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of NSUN5 from Human, Mouse. This NSUN5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NSUN5 protein at amino acid sequence of 320-400
NSUN5 Rabbit pAb
A5992-100ul 100 ul
EUR 308
NSUN5 Rabbit pAb
A5992-200ul 200 ul
EUR 459
NSUN5 Rabbit pAb
A5992-20ul 20 ul
EUR 183
NSUN5 Rabbit pAb
A5992-50ul 50 ul
EUR 223
NSUN5 antibody
70R-18973 50 ul
EUR 435
Description: Rabbit polyclonal NSUN5 antibody
NSUN5 Antibody
1-CSB-PA839386LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NSUN5. Recognizes NSUN5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
NSUN5 Antibody
1-CSB-PA016113GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NSUN5. Recognizes NSUN5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
anti- NSUN5 antibody
FNab05871 100µg
EUR 505.25
  • Immunogen: NOL1/NOP2/Sun domain family, member 5
  • Uniprot ID: Q96P11
  • Gene ID: 55695
  • Research Area: Metabolism
Description: Antibody raised against NSUN5
Anti-NSUN5 antibody
PAab05871 100 ug
EUR 355
Anti-NSUN5 antibody
STJ11100922 100 µl
EUR 277
Description: This gene encodes a member of an evolutionarily conserved family of proteins that may function as methyltransferases. This gene is located in a larger region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. There are two pseudogenes for this gene located in the same region of chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms.
Anti-NSUN5 antibody
STJ191231 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NSUN5
NSUN5 siRNA
20-abx926466
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NSUN5 siRNA
20-abx926467
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
NSUN5 Antibody, HRP conjugated
1-CSB-PA839386LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NSUN5. Recognizes NSUN5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
NSUN5 Antibody, FITC conjugated
1-CSB-PA839386LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NSUN5. Recognizes NSUN5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
NSUN5 Antibody, Biotin conjugated
1-CSB-PA839386LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NSUN5. Recognizes NSUN5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human Putative methyltransferase NSUN5, NSUN5 ELISA KIT
ELI-21343h 96 Tests
EUR 824
Mouse Putative methyltransferase NSUN5, Nsun5 ELISA KIT
ELI-22283m 96 Tests
EUR 865
NSUN5 cloning plasmid
CSB-CL839386HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: atggggctgtatgctgcagctgcaggcgtgttggccggcgtggagagccgccagggctctatcaaggggttggtgtactccagcaacttccagaacgtgaagcagctgtacgcgctggtgtgcgaaacgcagcgctactccgccgtgctggatgctgtgatcgccagcgccggcc
  • Show more
Description: A cloning plasmid for the NSUN5 gene.
Mouse NSUN5 shRNA Plasmid
20-abx979454
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NSUN5 ELISA KIT|Human
EF001342 96 Tests
EUR 689
Human NSUN5 shRNA Plasmid
20-abx960838
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
NSUN5 Recombinant Protein (Human)
RP021715 100 ug Ask for price
NSUN5 Recombinant Protein (Rat)
RP214634 100 ug Ask for price
NSUN5 Recombinant Protein (Mouse)
RP155162 100 ug Ask for price
NSUN5 ORF Vector (Human) (pORF)
ORF007239 1.0 ug DNA
EUR 95
Nsun5 ORF Vector (Rat) (pORF)
ORF071546 1.0 ug DNA
EUR 506

NSUN5 Rabbit Polyclonal Antibody