VAT1 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 VAT1 Polyclonal Antibody |
|
29967-50ul |
SAB |
50ul |
EUR 187 |
|
VAT1 Polyclonal Antibody |
|
ABP60872-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein |
|
VAT1 Polyclonal Antibody |
|
ABP60872-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein |
|
VAT1 Polyclonal Antibody |
|
ABP60872-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VAT1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VAT1 from Human, Mouse, Rat. This VAT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VAT1 protein |
|
VAT1 Polyclonal Antibody |
|
ES10330-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VAT1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
VAT1 Polyclonal Antibody |
|
ES10330-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VAT1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 VAT1 Polyclonal Conjugated Antibody |
|
C29967 |
SAB |
100ul |
EUR 397 |
 VAT1 antibody |
|
70R-4508 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal VAT1 antibody |
 [KO Validated] VAT1 Rabbit pAb |
|
A17077-100ul |
Abclonal |
100 ul |
EUR 308 |
|
[KO Validated] VAT1 Rabbit pAb |
|
A17077-200ul |
Abclonal |
200 ul |
EUR 459 |
|
[KO Validated] VAT1 Rabbit pAb |
|
A17077-20ul |
Abclonal |
20 ul |
EUR 183 |
|
[KO Validated] VAT1 Rabbit pAb |
|
A17077-50ul |
Abclonal |
50 ul |
EUR 223 |
 anti- VAT1 antibody |
|
FNab09376 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:1000-1:10000
- IHC: 1:20-1:200
- Immunogen: vesicle amine transport protein 1 homolog
- Uniprot ID: Q99536
- Gene ID: 10493
- Research Area: Metabolism, Developmental biology
|
|
Description: Antibody raised against VAT1 |
 Anti-VAT1 antibody |
|
STJ191488 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to VAT1 |
 VAT1 siRNA |
|
20-abx906008 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
VAT1 siRNA |
|
20-abx939346 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
VAT1 siRNA |
|
20-abx939347 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-VAT1 |
|
YF-PA25592 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to VAT1 |
 VAT1 Blocking Peptide |
|
33R-7240 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VAT1 antibody, catalog no. 70R-4508 |
 VAT1 cloning plasmid |
|
CSB-CL857863HU-10ug |
Cusabio |
10ug |
EUR 440 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1182
- Sequence: atgtccgacgagagagaggtagccgaggcagcgaccggggaagacgcctcttcgccgcctccgaaaaccgaggcagcgagcgacccccagcatcccgcggcctccgaaggggccgccgccgccgccgcctcgccgccactgctgcgctgcctagtgctcaccggctttggaggct
- Show more
|
|
Description: A cloning plasmid for the VAT1 gene. |
) Anti-VAT1 (3E9) |
|
YF-MA17337 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to VAT1 |
) VAT1 protein (His tag) |
|
80R-2081 |
Fitzgerald |
50 ug |
EUR 424 |
|
Description: Recombinant human VAT1 protein (His tag) |
 Rat VAT1 shRNA Plasmid |
|
20-abx988270 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse VAT1 shRNA Plasmid |
|
20-abx973802 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human VAT1 shRNA Plasmid |
|
20-abx957130 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) VAT1 Recombinant Protein (Rat) |
|
RP236288 |
ABM |
100 ug |
Ask for price |
) VAT1 Recombinant Protein (Human) |
|
RP034264 |
ABM |
100 ug |
Ask for price |
) VAT1 Recombinant Protein (Mouse) |
|
RP183662 |
ABM |
100 ug |
Ask for price |
 (pORF)) Vat1 ORF Vector (Mouse) (pORF) |
|
ORF061222 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Vat1 ORF Vector (Rat) (pORF) |
|
ORF078764 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) VAT1 ORF Vector (Human) (pORF) |
|
ORF011422 |
ABM |
1.0 ug DNA |
EUR 95 |
 (OKEH08378)) VAT1 ELISA Kit (Human) (OKEH08378) |
|
OKEH08378 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. The protein encoded by this gene is an abundant integral membrane protein of cholinergic synaptic vesicles and is thought to be involved in vesicular transport. It belongs to the quinone oxidoreductase subfamily of zinc-containing alcohol dehydrogenase proteins.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
) Vat1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4763801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Vat1 sgRNA CRISPR Lentivector set (Rat) |
|
K7470001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) VAT1 sgRNA CRISPR Lentivector set (Human) |
|
K2606101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) Synaptic Vesicle Membrane Protein VAT-1 Homolog (VAT1) Antibody |
|
abx239376-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (Target 1)) Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4763802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4763803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vat1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4763804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Vat1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7470002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Vat1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7470003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Vat1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7470004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) VAT1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2606102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) VAT1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2606103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) VAT1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2606104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) VAT1 Protein Vector (Mouse) (pPB-C-His) |
|
PV244886 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) VAT1 Protein Vector (Mouse) (pPB-N-His) |
|
PV244887 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) VAT1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV244888 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) VAT1 Protein Vector (Mouse) (pPM-C-His) |
|
PV244889 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) VAT1 Protein Vector (Rat) (pPB-C-His) |
|
PV315054 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) VAT1 Protein Vector (Rat) (pPB-N-His) |
|
PV315055 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) VAT1 Protein Vector (Rat) (pPM-C-HA) |
|
PV315056 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) VAT1 Protein Vector (Rat) (pPM-C-His) |
|
PV315057 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) VAT1 Protein Vector (Human) (pPB-C-His) |
|
PV045685 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) VAT1 Protein Vector (Human) (pPB-N-His) |
|
PV045686 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) VAT1 Protein Vector (Human) (pPM-C-HA) |
|
PV045687 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) VAT1 Protein Vector (Human) (pPM-C-His) |
|
PV045688 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human VAT1 Protein, His, E.coli-10ug |
|
QP13926-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human VAT1 Protein, His, E.coli-1mg |
|
QP13926-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human VAT1 Protein, His, E.coli-2ug |
|
QP13926-2ug |
EnQuireBio |
2ug |
EUR 155 |
 Vat1 3'UTR Luciferase Stable Cell Line |
|
TU121734 |
ABM |
1.0 ml |
Ask for price |
 VAT1 3'UTR GFP Stable Cell Line |
|
TU078058 |
ABM |
1.0 ml |
EUR 1394 |
 Vat1 3'UTR GFP Stable Cell Line |
|
TU171734 |
ABM |
1.0 ml |
Ask for price |
|
Vat1 3'UTR Luciferase Stable Cell Line |
|
TU223008 |
ABM |
1.0 ml |
Ask for price |
 VAT1 3'UTR Luciferase Stable Cell Line |
|
TU028058 |
ABM |
1.0 ml |
EUR 1394 |
|
Vat1 3'UTR GFP Stable Cell Line |
|
TU273008 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) VAT1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV637531 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) VAT1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV637535 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) VAT1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV637536 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) VAT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV793219 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) VAT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV793220 |
ABM |
1.0 ug DNA |
EUR 316 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
|
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
|
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
|
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
|
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
|
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
|
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
|
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
|
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
|
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
|
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
|
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
|
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
|
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
|
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
|
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
|
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
|
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
|
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
|
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
|
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
|
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
VAT1 Rabbit Polyclonal Antibody
pCMV-SPORT6-VAT1 
Mouse Vat1 ELISA KIT 
VAT1 ELISA KIT|Human 
Human VAT1 ELISA KIT 