YSK4 Rabbit Polyclonal Antibody

YSK4 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

YSK4 Polyclonal Antibody
ABP60945-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human YSK4 protein Applications tips:
Description: A polyclonal antibody for detection of YSK4 from Human. This YSK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YSK4 protein

YSK4 Polyclonal Antibody
ABP60945-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human YSK4 protein Applications tips:
Description: A polyclonal antibody for detection of YSK4 from Human. This YSK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YSK4 protein

YSK4 Polyclonal Antibody
ABP60945-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human YSK4 protein Applications tips:
Description: A polyclonal antibody for detection of YSK4 from Human. This YSK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human YSK4 protein

Anti-YSK4 antibody
STJ191471	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to YSK4

SPS1/STE20-Related Protein Kinase YSK4 (YSK4) Antibody
abx036782-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

anti-YSK4
YF-PA21006	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to YSK4

Antibody for Human YSK4
SPC-1216D	Stressmarq	0.1ml	EUR 354
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is unconjugated.

Antibody for Human YSK4
SPC-1216D-A390	Stressmarq	0.1ml	EUR 401
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 390.

Antibody for Human YSK4
SPC-1216D-A488	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 488.

Antibody for Human YSK4
SPC-1216D-A565	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 565.

Antibody for Human YSK4
SPC-1216D-A594	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 594.

Antibody for Human YSK4
SPC-1216D-A633	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 633.

Antibody for Human YSK4
SPC-1216D-A655	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 655.

Antibody for Human YSK4
SPC-1216D-A680	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 680.

Antibody for Human YSK4
SPC-1216D-A700	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 700.

Antibody for Human YSK4
SPC-1216D-ALP	Stressmarq	0.1ml	EUR 394
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human YSK4
SPC-1216D-APC	Stressmarq	0.1ml	EUR 399
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC .

Antibody for Human YSK4
SPC-1216D-APCCY7	Stressmarq	0.1ml	EUR 471
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC/Cy7.

Antibody for Human YSK4
SPC-1216D-BI	Stressmarq	0.1ml	EUR 396
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Biotin.

Antibody for Human YSK4
SPC-1216D-DY350	Stressmarq	0.1ml	EUR 475
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 350.

Antibody for Human YSK4
SPC-1216D-DY405	Stressmarq	0.1ml	EUR 452
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 405.

Antibody for Human YSK4
SPC-1216D-DY488	Stressmarq	0.1ml	EUR 432
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 488.

Antibody for Human YSK4
SPC-1216D-DY594	Stressmarq	0.1ml	EUR 436
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 594.

Antibody for Human YSK4
SPC-1216D-DY633	Stressmarq	0.1ml	EUR 426
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 633.

Antibody for Human YSK4
SPC-1216D-FITC	Stressmarq	0.1ml	EUR 392
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to FITC.

Antibody for Human YSK4
SPC-1216D-HRP	Stressmarq	0.1ml	EUR 388
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to HRP.

Antibody for Human YSK4
SPC-1216D-P594	Stressmarq	0.1ml	EUR 407
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PE/ATTO 594.

Antibody for Human YSK4
SPC-1216D-PCP	Stressmarq	0.1ml	EUR 399
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PerCP.

Antibody for Human YSK4
SPC-1216D-RPE	Stressmarq	0.1ml	EUR 397
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to RPE .

Antibody for Human YSK4
SPC-1216D-STR	Stressmarq	0.1ml	EUR 398
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide corresponding to the N-terminus of human YSK4 (AA1-15). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Streptavidin.

Antibody for Human YSK4
SPC-1217D	Stressmarq	0.1ml	EUR 354
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is unconjugated.

Antibody for Human YSK4
SPC-1217D-A390	Stressmarq	0.1ml	EUR 401
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 390.

Antibody for Human YSK4
SPC-1217D-A488	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 488.

Antibody for Human YSK4
SPC-1217D-A565	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 565.

Antibody for Human YSK4
SPC-1217D-A594	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 594.

Antibody for Human YSK4
SPC-1217D-A633	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 633.

Antibody for Human YSK4
SPC-1217D-A655	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 655.

Antibody for Human YSK4
SPC-1217D-A680	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 680.

Antibody for Human YSK4
SPC-1217D-A700	Stressmarq	0.1ml	EUR 400
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to ATTO 700.

Antibody for Human YSK4
SPC-1217D-ALP	Stressmarq	0.1ml	EUR 394
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human YSK4
SPC-1217D-APC	Stressmarq	0.1ml	EUR 399
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC .

Antibody for Human YSK4
SPC-1217D-APCCY7	Stressmarq	0.1ml	EUR 471
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to APC/Cy7.

Antibody for Human YSK4
SPC-1217D-BI	Stressmarq	0.1ml	EUR 396
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Biotin.

Antibody for Human YSK4
SPC-1217D-DY350	Stressmarq	0.1ml	EUR 475
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 350.

Antibody for Human YSK4
SPC-1217D-DY405	Stressmarq	0.1ml	EUR 452
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 405.

Antibody for Human YSK4
SPC-1217D-DY488	Stressmarq	0.1ml	EUR 432
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 488.

Antibody for Human YSK4
SPC-1217D-DY594	Stressmarq	0.1ml	EUR 436
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 594.

Antibody for Human YSK4
SPC-1217D-DY633	Stressmarq	0.1ml	EUR 426
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Dylight 633.

Antibody for Human YSK4
SPC-1217D-FITC	Stressmarq	0.1ml	EUR 392
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to FITC.

Antibody for Human YSK4
SPC-1217D-HRP	Stressmarq	0.1ml	EUR 388
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to HRP.

Antibody for Human YSK4
SPC-1217D-P594	Stressmarq	0.1ml	EUR 407
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PE/ATTO 594.

Antibody for Human YSK4
SPC-1217D-PCP	Stressmarq	0.1ml	EUR 399
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to PerCP.

Antibody for Human YSK4
SPC-1217D-RPE	Stressmarq	0.1ml	EUR 397
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to RPE .

Antibody for Human YSK4
SPC-1217D-STR	Stressmarq	0.1ml	EUR 398
YSK4 (YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)), also known as RCK (regulated in COPD, protein kinase), is a 1,328 amino acid protein that belongs to the STE Ser/Thr protein kinase family, STE20 subfamily and protein kinase superfamily. Show more
Description: A polyclonal antibody for YSK4 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human YSK4 (AA350-366). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This YSK4 antibody is conjugated to Streptavidin.

YSK4 cloning plasmid
CSB-CL707114HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 507 Sequence: atggagtttgttcctggtggctcaatctctagtattataaaccgttttgggccattgcctgagatggtgttctgtaaatatacgaaacaaatacttcaaggtgttgcttatctccatgagaactgtgtggtacatcgcgatatcaaaggaaataatgttatgctcatgccaactgg Show more
Description: A cloning plasmid for the YSK4 gene.

Anti-YSK4 (2A4)
YF-MA19390	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to YSK4

Human SPS1/STE20- related protein kinase YSK4, YSK4 ELISA KIT
ELI-28798h	Lifescience Market	96 Tests	EUR 824

YSK4 ORF Vector (Human) (pORF)
ORF011686	ABM	1.0 ug DNA	EUR 95

Ysk4 ORF Vector (Mouse) (pORF)
ORF062027	ABM	1.0 ug DNA	EUR 506

YSK4 sgRNA CRISPR Lentivector set (Human)
K2656401	ABM	3 x 1.0 ug	EUR 339

Ysk4 sgRNA CRISPR Lentivector set (Mouse)
K3128301	ABM	3 x 1.0 ug	EUR 339

YSK4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2656402	ABM	1.0 ug DNA	EUR 154

YSK4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2656403	ABM	1.0 ug DNA	EUR 154

YSK4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2656404	ABM	1.0 ug DNA	EUR 154

Ysk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3128302	ABM	1.0 ug DNA	EUR 154

Ysk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3128303	ABM	1.0 ug DNA	EUR 154

Ysk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3128304	ABM	1.0 ug DNA	EUR 154

YSK4 Protein Vector (Human) (pPB-C-His)
PV046741	ABM	500 ng	EUR 329

YSK4 Protein Vector (Human) (pPB-N-His)
PV046742	ABM	500 ng	EUR 329

YSK4 Protein Vector (Human) (pPM-C-HA)
PV046743	ABM	500 ng	EUR 329

YSK4 Protein Vector (Human) (pPM-C-His)
PV046744	ABM	500 ng	EUR 329

YSK4 Protein Vector (Mouse) (pPB-C-His)
PV248106	ABM	500 ng	EUR 1065

YSK4 Protein Vector (Mouse) (pPB-N-His)
PV248107	ABM	500 ng	EUR 1065

YSK4 Protein Vector (Mouse) (pPM-C-HA)
PV248108	ABM	500 ng	EUR 1065

YSK4 Protein Vector (Mouse) (pPM-C-His)
PV248109	ABM	500 ng	EUR 1065

Ysk4 3'UTR GFP Stable Cell Line
TU172441	ABM	1.0 ml	Ask for price

YSK4 3'UTR GFP Stable Cell Line
TU078663	ABM	1.0 ml	EUR 1394

Ysk4 3'UTR Luciferase Stable Cell Line
TU122441	ABM	1.0 ml	Ask for price

YSK4 3'UTR Luciferase Stable Cell Line
TU028663	ABM	1.0 ml	EUR 1394

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

YSK4 Rabbit Polyclonal Antibody