October 23, 2021

PLTP Rabbit Polyclonal Antibody

PLTP Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PLTP Polyclonal Antibody

ES10007-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLTP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PLTP Polyclonal Antibody

ABP59951-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260

PLTP Polyclonal Antibody

ABP59951-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260

PLTP Polyclonal Antibody

ABP59951-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of PLTP from Human, Mouse. This PLTP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLTP protein at amino acid sequence of 180-260

PLTP Polyclonal Antibody

A53320 100 µg
EUR 570.55
Description: The best epigenetics products

Human Phospholipid Transfer Protein (PLTP) ELISA Kit

EUR 517
  • Should the Human Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit

EUR 673
  • Should the Human Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

EUR 549
  • Should the Rat Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

EUR 718
  • Should the Rat Phospholipid Transfer Protein (PLTP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Phospholipid Transfer Protein (PLTP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Phospholipid Transfer Protein (PLTP) ELISA Kit

RD-PLTP-Hu-48Tests 48 Tests
EUR 521

Human Phospholipid Transfer Protein (PLTP) ELISA Kit

RD-PLTP-Hu-96Tests 96 Tests
EUR 723

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

RD-PLTP-Ra-48Tests 48 Tests
EUR 557

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

RD-PLTP-Ra-96Tests 96 Tests
EUR 775

Human Phospholipid Transfer Protein (PLTP) ELISA Kit

RDR-PLTP-Hu-48Tests 48 Tests
EUR 544

Human Phospholipid Transfer Protein (PLTP) ELISA Kit

RDR-PLTP-Hu-96Tests 96 Tests
EUR 756

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

RDR-PLTP-Ra-48Tests 48 Tests
EUR 583

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

RDR-PLTP-Ra-96Tests 96 Tests
EUR 811

PLTP Rabbit pAb

A5628-100ul 100 ul
EUR 308

PLTP Rabbit pAb

A5628-200ul 200 ul
EUR 459

PLTP Rabbit pAb

A5628-20ul 20 ul
EUR 183

PLTP Rabbit pAb

A5628-50ul 50 ul
EUR 223


ERTP0138 96Tests
EUR 521

Polyclonal PLTP Antibody (aa470-490)

AMR09388G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (aa470-490). This antibody is tested and proven to work in the following applications:

Polyclonal PLTP Antibody (C-term)

AMR09389G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLTP (C-term). This antibody is tested and proven to work in the following applications:

PLTP Polyclonal Antibody, Biotin Conjugated

A53317 100 µg
EUR 570.55
Description: Ask the seller for details

PLTP Polyclonal Antibody, FITC Conjugated

A53318 100 µg
EUR 570.55
Description: The best epigenetics products

PLTP Polyclonal Antibody, HRP Conjugated

A53319 100 µg
EUR 570.55
Description: kits suitable for this type of research

PLTP Antibody

ABD7426 100 ug
EUR 438

PLTP Antibody

EUR 327

PLTP Antibody

EUR 146

PLTP Antibody

32933-100ul 100ul
EUR 252

PLTP antibody

70R-11938 100 ug
EUR 418
Description: Rabbit polyclonal PLTP antibody

PLTP antibody

70R-10288 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PLTP antibody

PLTP Antibody

DF7426 200ul
EUR 304
Description: PLTP Antibody detects endogenous levels of total PLTP.

PLTP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

PLTP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PLTP Conjugated Antibody

C32933 100ul
EUR 397

Anti-PLTP Antibody

PA2228 100ug/vial
EUR 334

Anti-PLTP antibody

STJ27595 100 µl
EUR 277
Description: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.

Anti-PLTP antibody

STJ191165 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLTP

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP)

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT12200 2 ug
EUR 391


YF-PA13839 50 ul
EUR 363
Description: Mouse polyclonal to PLTP


YF-PA13840 100 ug
EUR 403
Description: Rabbit polyclonal to PLTP


YF-PA24404 50 ul
EUR 334
Description: Mouse polyclonal to PLTP

PLTP Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PLTP Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PLTP Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLTP. Recognizes PLTP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Biotin.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with Cy3.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with FITC.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with HRP.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with PE.

Rabbit Phospholipid Transfer Protein (PLTP) ELISA Kit

abx363002-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

PLTP cloning plasmid

CSB-CL018212HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagtgttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
  • Show more
Description: A cloning plasmid for the PLTP gene.

PLTP cloning plasmid

CSB-CL018212HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: atggccctcttcggggccctcttcctagcgctgctggcaggcgcacatgcagagttcccaggctgcaagatccgcgtcacctccaaggcgctggagctggtgaagcaggaggggctgcgctttctggagcaagagctggagactatcaccattccggacctgcggggcaaagaag
  • Show more
Description: A cloning plasmid for the PLTP gene.

PLTP Blocking Peptide

33R-6693 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-10288

PLTP Blocking Peptide

33R-10824 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLTP antibody, catalog no. 70R-11938

PLTP Blocking Peptide

EUR 153

PLTP Blocking Peptide

DF7426-BP 1mg
EUR 195

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

abx146426-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

abx033529-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

abx033529-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Phospholipid Transfer Protein (PLTP) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Asp479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7.

Phospholipid Transfer Protein (PLTP) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLTP (Ile337~Gly479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Phospholipid Transfer Protein (PLTP). This antibody is labeled with APC-Cy7.


EHP0138 96Tests
EUR 521


EGTP0138 96Tests
EUR 521


EBP0138 96Tests
EUR 521

Chicken PLTP ELISA Kit

ECKP0138 96Tests
EUR 521

Anserini PLTP ELISA Kit

EAP0138 96Tests
EUR 521


ECP0138 96Tests
EUR 521


EF007098 96 Tests
EUR 689

Porcine PLTP ELISA Kit

EPP0138 96Tests
EUR 521


ERP0138 96Tests
EUR 521


ESP0138 96Tests
EUR 521


EMKP0138 96Tests
EUR 521


EMP0138 96Tests
EUR 521

Human PLTP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PLTP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PLTP Recombinant Protein (Human)

RP023854 100 ug Ask for price

PLTP Recombinant Protein (Human)

RP023857 100 ug Ask for price

PLTP Recombinant Protein (Rat)

RP221072 100 ug Ask for price

PLTP Recombinant Protein (Mouse)

RP162998 100 ug Ask for price

Anti-PLTP (2F3-G4)

YF-MA10707 100 ug
EUR 363
Description: Mouse monoclonal to PLTP

Mouse PLTP PicoKine ELISA Kit

EK1368 96 wells
EUR 425
Description: For quantitative detection of mouse PLTP in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Mouse PLTP

EK5632 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse PLTP in samples from serum, plasma, tissue homogenates and other biological fluids.

Guinea Pig PLTP ELISA Kit

EGP0138 96Tests
EUR 521

PLTP Inhibitor Drug Screening Kit

55R-1448 100 assays
EUR 920
Description: Screening Kit for detection of PLTP Inhibitor in the research laboratory

PLTP Activity Fluorometric Assay Kit

K2087-100 100 assays
EUR 669

Human Phospholipid transfer protein (PLTP)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in Yeast

Human Phospholipid transfer protein (PLTP)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 80.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Phospholipid transfer protein(PLTP) expressed in E.coli

PLTP ORF Vector (Human) (pORF)

ORF007952 1.0 ug DNA
EUR 95

PLTP ORF Vector (Human) (pORF)

ORF007953 1.0 ug DNA
EUR 95

Pltp ORF Vector (Rat) (pORF)

ORF073692 1.0 ug DNA
EUR 506

Pltp ORF Vector (Mouse) (pORF)

ORF054334 1.0 ug DNA
EUR 506

Recombinant Phospholipid Transfer Protein (PLTP)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P55065
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 10.1
Description: Recombinant Mouse Phospholipid Transfer Protein expressed in: E.coli

Recombinant Phospholipid Transfer Protein (PLTP)

  • EUR 469.15
  • EUR 229.00
  • EUR 1484.32
  • EUR 561.44
  • EUR 1022.88
  • EUR 377.00
  • EUR 3560.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: E9PSP1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Phospholipid Transfer Protein expressed in: E.coli

PLTP ELISA Kit (Human) (OKCD01695)

OKCD01695 96 Wells
EUR 831
Description: Description of target: Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Essential for the transfer of excess surface lipids from triglyceride-rich lipoproteins to HDL, thereby facilitating the formation of smaller lipoprotein remnants, contributing to the formation of LDL, and assisting in the maturation of HDL particles. PLTP also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer PC from phospholipid vesicles to high-density lipoproteins (HDL), and an inactive form that lacks this capability. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL

PLTP ELISA Kit (Human) (OKAN06516)

OKAN06516 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.135 ng/mL

PLTP ELISA Kit (Rat) (OKCD04388)

OKCD04388 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.4 ng/mL

PLTP ELISA Kit (Mouse) (OKCD08236)

OKCD08236 96 Wells
EUR 1001
Description: Description of target: Phospholipid transfer protein (PLTP), also known as lipid transfer protein II is a protein that in humans is encoded by the PLTP gene. This gene is mapped to 20q13.12. The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL

PLTP ELISA Kit (Mouse) (OKBB00625)

OKBB00625 96 Wells
EUR 505
Description: Description of target: Phospholipid transfer protein (PLTP), also known as lipid transfer protein II is a protein that in humans is encoded by the PLTP gene. This gene is mapped to 20q13.12. The protein encoded by this gene is one of at least two lipid transfer proteins found in human plasma. The encoded protein transfers phospholipids from triglyceride-rich lipoproteins to high density lipoprotein (HDL). In addition to regulating the size of HDL particles, this protein may be involved in cholesterol metabolism. At least two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 20 pg/mL

PLTP ELISA Kit (Human) (OKCA02131)

OKCA02131 96 Wells
EUR 917
Description: Description of target: Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Essential for the transfer of excess surface lipids from triglyceride-rich lipoproteins to HDL, thereby facilitating the formation of smaller lipoprotein remnants, contributing to the formation of LDL, and assisting in the maturation of HDL particles. PLTP also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer PC from phospholipid vesicles to high-density lipoproteins (HDL), and an inactive form that lacks this capability. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.58 ng/mL

Monoclonal PLTP Antibody (monoclonal) (M01), Clone: 2F3-G4

AMR09390G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PLTP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F3-G4. This antibody is applicable in WB and IHC

Human Phospholipid Transfer Protein (PLTP) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Phospholipid Transfer Protein (PLTP) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Phospholipid Transfer Protein (PLTP) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PLTP sgRNA CRISPR Lentivector set (Human)

K1671101 3 x 1.0 ug
EUR 339

PLTP Activity Fluorometric Assay Kit II

EUR 588

Pltp sgRNA CRISPR Lentivector set (Mouse)

K4829701 3 x 1.0 ug
EUR 339

PLTP Inhibitor Drug Screening Kit (Fluorometric)

EUR 615

Pltp sgRNA CRISPR Lentivector set (Rat)

K6759701 3 x 1.0 ug
EUR 339

Pig Phospholipid Transfer Protein (PLTP) ELISA Kit

abx361115-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human PLTP(Phospholipid Transfer Protein) ELISA Kit

EH3621 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P55058
  • Alias: PLTP/HDLCQ9/Lipid transfer protein II/phospholipid transfer protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Phospholipid transfer protein, Pltp ELISA KIT

ELI-21705m 96 Tests
EUR 865

Human Phospholipid transfer protein, PLTP ELISA KIT

ELI-15355h 96 Tests
EUR 824

Rat Phospholipid Transfer Protein (PLTP) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Phospholipid Transfer Protein (PLTP) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

PLTP Rabbit Polyclonal Antibody