October 28, 2021

SASH3 Rabbit Polyclonal Antibody

SASH3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SASH3 Polyclonal Antibody

ABP60328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SASH3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SASH3 from Human, Mouse. This SASH3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SASH3 protein

SASH3 Polyclonal Antibody

ES10254-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SASH3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SASH3 Polyclonal Antibody

ES10254-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SASH3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SASH3 antibody

STJ191412 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SASH3

SASH3 siRNA

20-abx932481
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SASH3 siRNA

20-abx932482
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SASH3 cloning plasmid

CSB-CL020715HU-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1143
  • Sequence: atgctgcgccgcaagccctccaatgccagtgagaaggagcccactcagaagaaaaagctctcccttcagcgctccagcagcttcaaggattttgccaaatccaaacccagctcccccgtggtgagcgagaaggagtttaatctggatgataacattccagaagatgactcaggtg
  • Show more
Description: A cloning plasmid for the SASH3 gene.

SASH3 ELISA KIT|Human

EF005538 96 Tests
EUR 689

Mouse SASH3 shRNA Plasmid

20-abx978104
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SASH3 shRNA Plasmid

20-abx960058
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SASH3 Recombinant Protein (Human)

RP027613 100 ug Ask for price

SASH3 Recombinant Protein (Rat)

RP227492 100 ug Ask for price

SASH3 Recombinant Protein (Mouse)

RP170027 100 ug Ask for price

Sash3 ORF Vector (Rat) (pORF)

ORF075832 1.0 ug DNA
EUR 506

SASH3 ORF Vector (Human) (pORF)

ORF009205 1.0 ug DNA
EUR 95

Sash3 ORF Vector (Mouse) (pORF)

ORF056677 1.0 ug DNA
EUR 506

Sash3 sgRNA CRISPR Lentivector set (Rat)

K7446701 3 x 1.0 ug
EUR 339

Sash3 sgRNA CRISPR Lentivector set (Mouse)

K3443601 3 x 1.0 ug
EUR 339

SASH3 sgRNA CRISPR Lentivector set (Human)

K2090301 3 x 1.0 ug
EUR 339

Sash3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7446702 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7446703 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7446704 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3443602 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3443603 1.0 ug DNA
EUR 154

Sash3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3443604 1.0 ug DNA
EUR 154

SASH3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2090302 1.0 ug DNA
EUR 154

SASH3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2090303 1.0 ug DNA
EUR 154

SASH3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2090304 1.0 ug DNA
EUR 154

SASH3 Protein Vector (Rat) (pPB-C-His)

PV303326 500 ng
EUR 603

SASH3 Protein Vector (Rat) (pPB-N-His)

PV303327 500 ng
EUR 603

SASH3 Protein Vector (Rat) (pPM-C-HA)

PV303328 500 ng
EUR 603

SASH3 Protein Vector (Rat) (pPM-C-His)

PV303329 500 ng
EUR 603

SASH3 Protein Vector (Mouse) (pPB-C-His)

PV226706 500 ng
EUR 603

SASH3 Protein Vector (Mouse) (pPB-N-His)

PV226707 500 ng
EUR 603

SASH3 Protein Vector (Mouse) (pPM-C-HA)

PV226708 500 ng
EUR 603

SASH3 Protein Vector (Mouse) (pPM-C-His)

PV226709 500 ng
EUR 603

SASH3 Protein Vector (Human) (pPB-C-His)

PV036817 500 ng
EUR 329

SASH3 Protein Vector (Human) (pPB-N-His)

PV036818 500 ng
EUR 329

SASH3 Protein Vector (Human) (pPM-C-HA)

PV036819 500 ng
EUR 329

SASH3 Protein Vector (Human) (pPM-C-His)

PV036820 500 ng
EUR 329

Sash3 3'UTR Luciferase Stable Cell Line

TU118355 1.0 ml Ask for price

SASH3 Rabbit Polyclonal Antibody