October 23, 2021

RINT1 Rabbit Polyclonal Antibody

RINT1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RINT1 Polyclonal Antibody

ABP60177-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RINT1 protein at amino acid sequence of 550-630
  • Applications tips:
Description: A polyclonal antibody for detection of RINT1 from Human, Mouse. This RINT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RINT1 protein at amino acid sequence of 550-630

RINT1 Polyclonal Antibody

ABP60177-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RINT1 protein at amino acid sequence of 550-630
  • Applications tips:
Description: A polyclonal antibody for detection of RINT1 from Human, Mouse. This RINT1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RINT1 protein at amino acid sequence of 550-630

RINT1 Polyclonal Antibody

ES10083-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RINT1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RINT1 Polyclonal Antibody

ES10083-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RINT1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RINT1 antibody

70R-19901 50 ul
EUR 435
Description: Rabbit polyclonal RINT1 antibody

RINT1 Antibody

1-CSB-PA747351LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RINT1. Recognizes RINT1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RINT1 Antibody

1-CSB-PA019731GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RINT1. Recognizes RINT1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RINT1 Polyclonal Antibody, HRP Conjugated

A65475 100 µg
EUR 570.55
Description: Ask the seller for details

RINT1 Polyclonal Antibody, FITC Conjugated

A65476 100 µg
EUR 570.55
Description: The best epigenetics products

RINT1 Polyclonal Antibody, Biotin Conjugated

A65477 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- RINT1 antibody

FNab07309 100µg
EUR 505.25
  • Immunogen: RAD50 interactor 1
  • Uniprot ID: Q6NUQ1
  • Gene ID: 60561
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against RINT1

Anti-RINT1 antibody

PAab07309 100 ug
EUR 355

Anti-RINT1 antibody

STJ191241 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RINT1

Polyclonal RINT1 Antibody - N-terminal region

APR01863G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RINT1 - N-terminal region. This antibody is tested and proven to work in the following applications:

RINT1 siRNA

20-abx931554
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RINT1 siRNA

20-abx931555
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RINT1

YF-PA20389 50 ug
EUR 363
Description: Mouse polyclonal to RINT1

RINT1 Antibody, HRP conjugated

1-CSB-PA747351LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RINT1. Recognizes RINT1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RINT1 Antibody, FITC conjugated

1-CSB-PA747351LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RINT1. Recognizes RINT1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RINT1 Antibody, Biotin conjugated

1-CSB-PA747351LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RINT1. Recognizes RINT1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RINT1 cloning plasmid

CSB-CL747351HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2379
  • Sequence: atgctaccagccggcgagatcggcgcctctcctgcagccccgtgctgctctgaaagtggtgacgaaaggaagaacctcgaggagaaaagtgacataaatgttacagttcttattggaagtaaacaagtcagtgaaggtacagataatggtgatctcccttcttatgtgtctgcat
  • Show more
Description: A cloning plasmid for the RINT1 gene.

pCMV-SPORT6-RINT1

PVT13982 2 ug
EUR 391

RAD50 Interactor 1 (RINT1) Antibody

abx237309-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAD50 Interactor 1 (RINT1) Antibody

20-abx301439
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RINT1 ELISA KIT|Human

EF002478 96 Tests
EUR 689

Mouse RINT1 shRNA Plasmid

20-abx977852
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RINT1 shRNA Plasmid

20-abx961817
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-RINT1

PVT14242 2 ug
EUR 599

RINT1 Recombinant Protein (Human)

RP026473 100 ug Ask for price

RINT1 Recombinant Protein (Mouse)

RP168266 100 ug Ask for price

RAD50 Interactor 1 (RINT1) Antibody (HRP)

20-abx307873
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAD50 Interactor 1 (RINT1) Antibody (FITC)

20-abx307874
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAD50 Interactor 1 (RINT1) Antibody (Biotin)

20-abx307875
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RINT1 ORF Vector (Human) (pORF)

ORF008825 1.0 ug DNA
EUR 95

Rint1 ORF Vector (Mouse) (pORF)

ORF056090 1.0 ug DNA
EUR 506

Rint1 sgRNA CRISPR Lentivector set (Mouse)

K4669801 3 x 1.0 ug
EUR 339

RINT1 sgRNA CRISPR Lentivector set (Human)

K1825401 3 x 1.0 ug
EUR 339

Human RAD50 Interactor 1 (RINT1) ELISA Kit

abx382821-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rint1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4669802 1.0 ug DNA
EUR 154

Rint1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4669803 1.0 ug DNA
EUR 154

Rint1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4669804 1.0 ug DNA
EUR 154

RINT1 Rabbit Polyclonal Antibody