PSPC1 Rabbit Polyclonal Antibody

PSPC1 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PSPC1 Polyclonal Antibody
ES9973-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PSPC1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSPC1 Rabbit pAb
A9209-100ul	Abclonal	100 ul	EUR 308

PSPC1 Rabbit pAb
A9209-200ul	Abclonal	200 ul	EUR 459

PSPC1 Rabbit pAb
A9209-20ul	Abclonal	20 ul	EUR 183

PSPC1 Rabbit pAb
A9209-50ul	Abclonal	50 ul	EUR 223

PSPC1 Antibody
44675-100ul	SAB	100ul	EUR 252

PSPC1 Antibody
44675-50ul	SAB	50ul	EUR 187

PSPC1 Antibody
DF2220	Affbiotech	200ul	EUR 304
Description: PSPC1 antibody detects endogenous levels of total PSPC1.

PSPC1 Antibody
1-CSB-PA018937LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

PSPC1 Antibody
ABD2220	Lifescience Market	100 ug	EUR 438

Pspc1/ Rat Pspc1 ELISA Kit
ELI-43074r	Lifescience Market	96 Tests	EUR 886

PSPC1 Conjugated Antibody
C44675	SAB	100ul	EUR 397

anti- PSPC1 antibody
FNab06901	FN Test	100µg	EUR 505.25
Immunogen: paraspeckle component 1 Uniprot ID: Q8WXF1 Gene ID: 55269 Research Area: Metabolism, Developmental biology
Description: Antibody raised against PSPC1

Anti-PSPC1 antibody
PAab06901	Lifescience Market	100 ug	EUR 355

Anti-PSPC1 antibody
STJ116347	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified.

Anti-PSPC1 antibody
STJ191131	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PSPC1

PSPC1 siRNA
20-abx904331	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSPC1 siRNA
20-abx930223	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSPC1 siRNA
20-abx930224	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PSPC1 Antibody, HRP conjugated
1-CSB-PA018937LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSPC1 Antibody, FITC conjugated
1-CSB-PA018937LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSPC1 Antibody, Biotin conjugated
1-CSB-PA018937LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSPC1. Recognizes PSPC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSPC1 Blocking Peptide
DF2220-BP	Affbiotech	1mg	EUR 195

PSPC1 cloning plasmid
CSB-CL018937HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1182 Sequence: atgatgttaagaggaaacctgaagcaagtgcgcattgagaaaaacccggcccgccttcgcgccctggagtccgcggtgggcgagagcgagccggcggccgcggcagccatggcgctcgctcttgccggggagccggcaccgcccgcgcccgcgcctccagaggaccacccggacg Show more
Description: A cloning plasmid for the PSPC1 gene.

Paraspeckle Component 1 (PSPC1) Antibody
20-abx217640	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Paraspeckle Component 1 (PSPC1) Antibody
20-abx124686	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Paraspeckle Component 1 (PSPC1) Antibody
abx122059-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Paraspeckle Component 1 (PSPC1) Antibody
abx236901-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

PSPC1 ELISA KIT|Human
EF002145	Lifescience Market	96 Tests	EUR 689

Rat PSPC1 shRNA Plasmid
20-abx989361	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PSPC1 shRNA Plasmid
20-abx975719	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PSPC1 shRNA Plasmid
20-abx960609	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PSPC1 Recombinant Protein (Human)
RP025045	ABM	100 ug	Ask for price

PSPC1 Recombinant Protein (Mouse)
RP165395	ABM	100 ug	Ask for price

PSPC1 Recombinant Protein (Rat)
RP222725	ABM	100 ug	Ask for price

Pspc1 ORF Vector (Rat) (pORF)
ORF074243	ABM	1.0 ug DNA	EUR 506

PSPC1 ORF Vector (Human) (pORF)
ORF008349	ABM	1.0 ug DNA	EUR 95

Pspc1 ORF Vector (Mouse) (pORF)
ORF055133	ABM	1.0 ug DNA	EUR 506

PSPC1-OT1 Recombinant Protein (Human)
RP085503	ABM	100 ug	Ask for price

Pspc1 sgRNA CRISPR Lentivector set (Rat)
K7459201	ABM	3 x 1.0 ug	EUR 339

Pspc1 sgRNA CRISPR Lentivector set (Mouse)
K4813201	ABM	3 x 1.0 ug	EUR 339

PSPC1 sgRNA CRISPR Lentivector set (Human)
K1746901	ABM	3 x 1.0 ug	EUR 339

PSPC1-AS1 ORF Vector (Human) (pORF)
ORF028501	ABM	1.0 ug DNA	Ask for price

PSPC1-OT1 ORF Vector (Human) (pORF)
ORF028502	ABM	1.0 ug DNA	Ask for price

Chicken Paraspeckle component 1, PSPC1 ELISA KIT
ELI-15492c	Lifescience Market	96 Tests	EUR 928

Mouse Paraspeckle component 1, Pspc1 ELISA KIT
ELI-22155m	Lifescience Market	96 Tests	EUR 865

Bovine Paraspeckle component 1, PSPC1 ELISA KIT
ELI-30610b	Lifescience Market	96 Tests	EUR 928

Human Paraspeckle component 1, PSPC1 ELISA KIT
ELI-45456h	Lifescience Market	96 Tests	EUR 824

Human Paraspeckle Component 1 (PSPC1) ELISA Kit
abx382541-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7459202	ABM	1.0 ug DNA	EUR 154

Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7459203	ABM	1.0 ug DNA	EUR 154

Pspc1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7459204	ABM	1.0 ug DNA	EUR 154

Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4813202	ABM	1.0 ug DNA	EUR 154

Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4813203	ABM	1.0 ug DNA	EUR 154

Pspc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4813204	ABM	1.0 ug DNA	EUR 154

PSPC1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1746902	ABM	1.0 ug DNA	EUR 154

PSPC1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1746903	ABM	1.0 ug DNA	EUR 154

PSPC1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1746904	ABM	1.0 ug DNA	EUR 154

PSPC1 Protein Vector (Rat) (pPB-C-His)
PV296970	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Rat) (pPB-N-His)
PV296971	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Rat) (pPM-C-HA)
PV296972	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Rat) (pPM-C-His)
PV296973	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Human) (pPB-C-His)
PV033393	ABM	500 ng	EUR 329

PSPC1 Protein Vector (Human) (pPB-N-His)
PV033394	ABM	500 ng	EUR 329

PSPC1 Protein Vector (Human) (pPM-C-HA)
PV033395	ABM	500 ng	EUR 329

PSPC1 Protein Vector (Human) (pPM-C-His)
PV033396	ABM	500 ng	EUR 329

PSPC1 Protein Vector (Mouse) (pPB-C-His)
PV220530	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Mouse) (pPB-N-His)
PV220531	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Mouse) (pPM-C-HA)
PV220532	ABM	500 ng	EUR 603

PSPC1 Protein Vector (Mouse) (pPM-C-His)
PV220533	ABM	500 ng	EUR 603

Pspc1 3'UTR Luciferase Stable Cell Line
TU117206	ABM	1.0 ml	Ask for price

Pspc1 3'UTR GFP Stable Cell Line
TU167206	ABM	1.0 ml	Ask for price

Pspc1 3'UTR Luciferase Stable Cell Line
TU216996	ABM	1.0 ml	Ask for price

Pspc1 3'UTR GFP Stable Cell Line
TU266996	ABM	1.0 ml	Ask for price

PSPC1 3'UTR GFP Stable Cell Line
TU069112	ABM	1.0 ml	EUR 1394

PSPC1 3'UTR Luciferase Stable Cell Line
TU019112	ABM	1.0 ml	EUR 1394

PSPC1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV695761	ABM	1.0 ug DNA	EUR 682

PSPC1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV695765	ABM	1.0 ug DNA	EUR 682

PSPC1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV695766	ABM	1.0 ug DNA	EUR 682

PSPC1-OT1 Protein Vector (Human) (pPB-C-His)
PV114006	ABM	500 ng	Ask for price

PSPC1-OT1 Protein Vector (Human) (pPB-N-His)
PV114007	ABM	500 ng	Ask for price

PSPC1-OT1 Protein Vector (Human) (pPM-C-HA)
PV114008	ABM	500 ng	Ask for price

PSPC1-OT1 Protein Vector (Human) (pPM-C-His)
PV114009	ABM	500 ng	Ask for price

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

PSPC1 Rabbit Polyclonal Antibody