October 23, 2021

KCNH6 Rabbit Polyclonal Antibody

KCNH6 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

KCNH6 Polyclonal Antibody
ABP59019-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KCNH6 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of KCNH6 from Human, Rat. This KCNH6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNH6 protein at amino acid sequence of 230-310
KCNH6 Polyclonal Antibody
ABP59019-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KCNH6 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of KCNH6 from Human, Rat. This KCNH6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNH6 protein at amino acid sequence of 230-310
KCNH6 Polyclonal Antibody
ES10031-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KCNH6 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
KCNH6 Polyclonal Antibody
ES10031-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KCNH6 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
KCNH6 Rabbit pAb
A15522-100ul 100 ul
EUR 308
KCNH6 Rabbit pAb
A15522-200ul 200 ul
EUR 459
KCNH6 Rabbit pAb
A15522-20ul 20 ul
EUR 183
KCNH6 Rabbit pAb
A15522-50ul 50 ul
EUR 223
KCNH6 antibody
70R-1513 100 ug
EUR 377
Description: Rabbit polyclonal KCNH6 antibody
KCNH6 Antibody
40058-100ul 100ul
EUR 252
KCNH6 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNH6. Recognizes KCNH6 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
KCNH6 Antibody
DF9766 200ul
EUR 304
Description: KCNH6 Antibody detects endogenous levels of total KCNH6.
KCNH6 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KCNH6. Recognizes KCNH6 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:35-1:150
KCNH6 antibody
70R-5116 50 ug
EUR 467
Description: Rabbit polyclonal KCNH6 antibody
KCNH6 antibody
70R-5122 50 ug
EUR 467
Description: Rabbit polyclonal KCNH6 antibody
KCNH6 antibody
70R-5127 50 ug
EUR 467
Description: Rabbit polyclonal KCNH6 antibody
KCNH6 Antibody
ABD9766 100 ug
EUR 438
Polyclonal KCNH6 antibody - middle region
AMM06118G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KCNH6 - middle region. This antibody is tested and proven to work in the following applications:
Kcnh6/ Rat Kcnh6 ELISA Kit
ELI-31190r 96 Tests
EUR 886
KCNH6 Conjugated Antibody
C40058 100ul
EUR 397
Anti-KCNH6 antibody
STJ117717 100 µl
EUR 277
Description: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms.
Anti-KCNH6 antibody
STJ191189 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KCNH6
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KCNH6 Blocking Peptide
33R-3382 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNH6 antibody, catalog no. 70R-1513
KCNH6 Blocking Peptide
33R-5459 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNH6 antibody, catalog no. 70R-5122
KCNH6 Blocking Peptide
33R-7186 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNH6 antibody, catalog no. 70R-5127
KCNH6 Blocking Peptide
33R-7330 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KCNH6 antibody, catalog no. 70R-5116
KCNH6 Blocking Peptide
DF9766-BP 1mg
EUR 195
KCNH6 cloning plasmid
CSB-CL875652HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1509
  • Sequence: atgccggtccgcaggggccacgtcgctccccaaaacacttacctggacaccatcatccgcaagttcgagggccaaagtcggaagttcctgattgccaatgctcagatggagaactgcgccatcatttactgcaacgacggcttctgcgaactcttcggctactcccgagtggagg
  • Show more
Description: A cloning plasmid for the KCNH6 gene.
Anti-KCNH6 (3D9)
YF-MA19431 100 ug
EUR 363
Description: Mouse monoclonal to KCNH6
ELI-21370h 96 Tests
EUR 824
Rat KCNH6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human KCNH6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Kcnh6 ORF Vector (Rat) (pORF)
ORF068933 1.0 ug DNA
EUR 506
KCNH6 ORF Vector (Human) (pORF)
ORF005535 1.0 ug DNA
EUR 95
Kcnh6 ORF Vector (Mouse) (pORF)
ORF048350 1.0 ug DNA
EUR 506
Kcnh6 sgRNA CRISPR Lentivector set (Rat)
K7113801 3 x 1.0 ug
EUR 339
KCNH6 sgRNA CRISPR Lentivector set (Human)
K1119801 3 x 1.0 ug
EUR 339
Kcnh6 sgRNA CRISPR Lentivector set (Mouse)
K4714901 3 x 1.0 ug
EUR 339
Kcnh6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7113802 1.0 ug DNA
EUR 154
Kcnh6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7113803 1.0 ug DNA
EUR 154
Kcnh6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7113804 1.0 ug DNA
EUR 154
KCNH6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1119802 1.0 ug DNA
EUR 154
KCNH6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1119803 1.0 ug DNA
EUR 154
KCNH6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1119804 1.0 ug DNA
EUR 154
Kcnh6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4714902 1.0 ug DNA
EUR 154
Kcnh6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4714903 1.0 ug DNA
EUR 154
Kcnh6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4714904 1.0 ug DNA
EUR 154
KCNH6 Protein Vector (Human) (pPB-C-His)
PV022137 500 ng
EUR 329
KCNH6 Protein Vector (Human) (pPB-N-His)
PV022138 500 ng
EUR 329
KCNH6 Protein Vector (Human) (pPM-C-HA)
PV022139 500 ng
EUR 329
KCNH6 Protein Vector (Human) (pPM-C-His)
PV022140 500 ng
EUR 329
KCNH6 Protein Vector (Rat) (pPB-C-His)
PV275730 500 ng
EUR 1166
KCNH6 Protein Vector (Rat) (pPB-N-His)
PV275731 500 ng
EUR 1166
KCNH6 Protein Vector (Rat) (pPM-C-HA)
PV275732 500 ng
EUR 1166
KCNH6 Protein Vector (Rat) (pPM-C-His)
PV275733 500 ng
EUR 1166
KCNH6 Protein Vector (Mouse) (pPB-C-His)
PV193398 500 ng
EUR 1065
KCNH6 Protein Vector (Mouse) (pPB-N-His)
PV193399 500 ng
EUR 1065
KCNH6 Protein Vector (Mouse) (pPM-C-HA)
PV193400 500 ng
EUR 1065
KCNH6 Protein Vector (Mouse) (pPM-C-His)
PV193401 500 ng
EUR 1065
Kcnh6 3'UTR Luciferase Stable Cell Line
TU110424 1.0 ml Ask for price
Kcnh6 3'UTR GFP Stable Cell Line
TU160424 1.0 ml Ask for price
Kcnh6 3'UTR Luciferase Stable Cell Line
TU206569 1.0 ml Ask for price
Kcnh6 3'UTR GFP Stable Cell Line
TU256569 1.0 ml Ask for price
KCNH6 3'UTR GFP Stable Cell Line
TU061491 1.0 ml
EUR 1394
KCNH6 3'UTR Luciferase Stable Cell Line
TU011491 1.0 ml
EUR 1394
Potassium Voltage-Gated Channel Subfamily H Member 6 (KCNH6) Antibody
abx216381-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily H Member 6 (KCNH6) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Potassium Voltage-Gated Channel Subfamily H Member 6 (KCNH6) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
KCNH6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV664375 1.0 ug DNA
EUR 1355
KCNH6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV664379 1.0 ug DNA
EUR 1355
KCNH6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV664380 1.0 ug DNA
EUR 1355
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

KCNH6 Rabbit Polyclonal Antibody