October 23, 2021

PIGC Rabbit Polyclonal Antibody

PIGC Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

PIGC Polyclonal Antibody

ABP59911-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PIGC from Human, Mouse, Rat. This PIGC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250

PIGC Polyclonal Antibody

ABP59911-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of PIGC from Human, Mouse, Rat. This PIGC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250

PIGC Polyclonal Antibody

ES9990-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PIGC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGC Polyclonal Antibody

ES9990-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PIGC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGC antibody

70R-10196 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PIGC antibody

PIGC Antibody

46126-100ul 100ul
EUR 252

PIGC Antibody

46126-50ul 50ul
EUR 187

PIGC Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PIGC Antibody

DF9743 200ul
EUR 304
Description: PIGC Antibody detects endogenous levels of total PIGC.

PIGC Antibody

ABD9743 100 ug
EUR 438

Polyclonal PIGC Antibody (C-Term)

AMM07169G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGC (C-Term). This antibody is tested and proven to work in the following applications:

PIGC Polyclonal Antibody, Biotin Conjugated

A60263 100 µg
EUR 570.55
Description: The best epigenetics products

PIGC Polyclonal Antibody, FITC Conjugated

A60264 100 µg
EUR 570.55
Description: kits suitable for this type of research

PIGC Polyclonal Antibody, HRP Conjugated

A60265 100 µg
EUR 570.55
Description: fast delivery possible

Polyclonal PIGC antibody - C-terminal region

AMM07170G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGC - C-terminal region. This antibody is tested and proven to work in the following applications:

Pigc/ Rat Pigc ELISA Kit

ELI-37395r 96 Tests
EUR 886

PIGC Conjugated Antibody

C46126 100ul
EUR 397

Anti-PIGC antibody

STJ191148 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PIGC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA24370 50 ul
EUR 334
Description: Mouse polyclonal to PIGC

PIGC Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGC Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGC Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGC Blocking Peptide

33R-1593 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGC antibody, catalog no. 70R-10196

PIGC Blocking Peptide

DF9743-BP 1mg
EUR 195

PIGC cloning plasmid

CSB-CL856402HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 894
  • Sequence: atgtatgctcaacctgtgactaacaccaaggaggtcaagtggcagaaggtcttgtatgagcgacagccctttcctgataactatgtggaccggcgattcctggaagagctccggaaaaacatccatgctcggaaataccaatattgggctgtggtatttgagtccagtgtggtgat
  • Show more
Description: A cloning plasmid for the PIGC gene.

pENTR223-PIGC vector

PVT11696 2 ug
EUR 304

Anti-PIGC (1G2)

YF-MA14706 100 ug
EUR 363
Description: Mouse monoclonal to PIGC


ELI-22725b 96 Tests
EUR 928


ELI-22726h 96 Tests
EUR 824

Rat PIGC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PIGC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PIGC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Pigc ELISA KIT

ELI-35711m 96 Tests
EUR 865


PVT13332 2 ug
EUR 599

PIGC Recombinant Protein (Human)

RP023437 100 ug Ask for price

PIGC Recombinant Protein (Mouse)

RP162020 100 ug Ask for price

PIGC Recombinant Protein (Mouse)

RP162023 100 ug Ask for price

PIGC Recombinant Protein (Rat)

RP220469 100 ug Ask for price

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pigc ORF Vector (Rat) (pORF)

ORF073491 1.0 ug DNA
EUR 506

PIGC ORF Vector (Human) (pORF)

ORF007813 1.0 ug DNA
EUR 95

Pigc ORF Vector (Mouse) (pORF)

ORF054008 1.0 ug DNA
EUR 506

Pigc ORF Vector (Mouse) (pORF)

ORF054009 1.0 ug DNA
EUR 506

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pigc sgRNA CRISPR Lentivector set (Mouse)

K4909001 3 x 1.0 ug
EUR 339

Pigc sgRNA CRISPR Lentivector set (Rat)

K6625501 3 x 1.0 ug
EUR 339

PIGC sgRNA CRISPR Lentivector set (Human)

K1646901 3 x 1.0 ug
EUR 339

Pigc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4909002 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4909003 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4909004 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6625502 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6625503 1.0 ug DNA
EUR 154

Pigc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6625504 1.0 ug DNA
EUR 154

PIGC sgRNA CRISPR Lentivector (Human) (Target 1)

K1646902 1.0 ug DNA
EUR 154

PIGC sgRNA CRISPR Lentivector (Human) (Target 2)

K1646903 1.0 ug DNA
EUR 154

PIGC sgRNA CRISPR Lentivector (Human) (Target 3)

K1646904 1.0 ug DNA
EUR 154

PIGC Protein Vector (Rat) (pPB-C-His)

PV293962 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPB-N-His)

PV293963 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPM-C-HA)

PV293964 500 ng
EUR 603

PIGC Protein Vector (Rat) (pPM-C-His)

PV293965 500 ng
EUR 603

PIGC Protein Vector (Human) (pPB-C-His)

PV031249 500 ng
EUR 329

PIGC Protein Vector (Human) (pPB-N-His)

PV031250 500 ng
EUR 329

PIGC Protein Vector (Human) (pPM-C-HA)

PV031251 500 ng
EUR 329

PIGC Protein Vector (Human) (pPM-C-His)

PV031252 500 ng
EUR 329

PIGC Protein Vector (Mouse) (pPB-C-His)

PV216030 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPB-N-His)

PV216031 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-HA)

PV216032 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-His)

PV216033 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPB-C-His)

PV216034 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPB-N-His)

PV216035 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-HA)

PV216036 500 ng
EUR 603

PIGC Protein Vector (Mouse) (pPM-C-His)

PV216037 500 ng
EUR 603

Pigc 3'UTR Luciferase Stable Cell Line

TU116347 1.0 ml Ask for price

Pigc 3'UTR GFP Stable Cell Line

TU166347 1.0 ml Ask for price

Pigc 3'UTR Luciferase Stable Cell Line

TU216226 1.0 ml Ask for price

Pigc 3'UTR GFP Stable Cell Line

TU266226 1.0 ml Ask for price

PIGC 3'UTR GFP Stable Cell Line

TU067929 1.0 ml
EUR 1394

PIGC 3'UTR Luciferase Stable Cell Line

TU017929 1.0 ml
EUR 1394

PIGC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV692587 1.0 ug DNA
EUR 514

PIGC Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV692591 1.0 ug DNA
EUR 514

PIGC Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV692592 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

PIGC Rabbit Polyclonal Antibody