PIGC Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 PIGC Polyclonal Antibody |
|
ABP59911-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PIGC from Human, Mouse, Rat. This PIGC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250 |
PIGC Polyclonal Antibody |
|
ABP59911-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PIGC from Human, Mouse, Rat. This PIGC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGC protein at amino acid sequence of 170-250 |
PIGC Polyclonal Antibody |
|
ES9990-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PIGC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGC Polyclonal Antibody |
|
ES9990-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PIGC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PIGC antibody |
|
70R-10196 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal PIGC antibody |
 PIGC Antibody |
|
46126-100ul |
SAB |
100ul |
EUR 252 |
PIGC Antibody |
|
46126-50ul |
SAB |
50ul |
EUR 187 |
PIGC Antibody |
|
1-CSB-PA856402LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
PIGC Antibody |
|
DF9743 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PIGC Antibody detects endogenous levels of total PIGC. |
) Polyclonal PIGC Antibody (C-Term) |
|
AMM07169G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGC (C-Term). This antibody is tested and proven to work in the following applications: |
 PIGC Polyclonal Antibody, Biotin Conjugated |
|
A60263 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 PIGC Polyclonal Antibody, FITC Conjugated |
|
A60264 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 PIGC Polyclonal Antibody, HRP Conjugated |
|
A60265 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 Polyclonal PIGC antibody - C-terminal region |
|
AMM07170G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGC - C-terminal region. This antibody is tested and proven to work in the following applications: |
 PIGC Conjugated Antibody |
|
C46126 |
SAB |
100ul |
EUR 397 |
 Anti-PIGC antibody |
|
STJ191148 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PIGC |
 PIGC siRNA |
|
20-abx904011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGC siRNA |
|
20-abx928561 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGC siRNA |
|
20-abx928562 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-PIGC |
|
YF-PA24370 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to PIGC |
 PIGC Antibody, HRP conjugated |
|
1-CSB-PA856402LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PIGC Antibody, FITC conjugated |
|
1-CSB-PA856402LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PIGC Antibody, Biotin conjugated |
|
1-CSB-PA856402LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGC. Recognizes PIGC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PIGC Blocking Peptide |
|
33R-1593 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGC antibody, catalog no. 70R-10196 |
PIGC Blocking Peptide |
|
DF9743-BP |
Affbiotech |
1mg |
EUR 195 |
 PIGC cloning plasmid |
|
CSB-CL856402HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 894
- Sequence: atgtatgctcaacctgtgactaacaccaaggaggtcaagtggcagaaggtcttgtatgagcgacagccctttcctgataactatgtggaccggcgattcctggaagagctccggaaaaacatccatgctcggaaataccaatattgggctgtggtatttgagtccagtgtggtgat
- Show more
|
|
Description: A cloning plasmid for the PIGC gene. |
) Anti-PIGC (1G2) |
|
YF-MA14706 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PIGC |
 Rat PIGC shRNA Plasmid |
|
20-abx990576 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse PIGC shRNA Plasmid |
|
20-abx976083 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PIGC shRNA Plasmid |
|
20-abx953527 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PIGC Recombinant Protein (Human) |
|
RP023437 |
ABM |
100 ug |
Ask for price |
) PIGC Recombinant Protein (Mouse) |
|
RP162020 |
ABM |
100 ug |
Ask for price |
PIGC Recombinant Protein (Mouse) |
|
RP162023 |
ABM |
100 ug |
Ask for price |
) PIGC Recombinant Protein (Rat) |
|
RP220469 |
ABM |
100 ug |
Ask for price |
 Antibody) Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody |
|
20-abx217764 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody |
|
20-abx310395 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Pigc ORF Vector (Rat) (pORF) |
|
ORF073491 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) PIGC ORF Vector (Human) (pORF) |
|
ORF007813 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pigc ORF Vector (Mouse) (pORF) |
|
ORF054008 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigc ORF Vector (Mouse) (pORF) |
|
ORF054009 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody (HRP)) Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (HRP) |
|
20-abx310396 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (FITC) |
|
20-abx310397 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit C (PIGC) Antibody (Biotin) |
|
20-abx310398 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Pigc sgRNA CRISPR Lentivector set (Mouse) |
|
K4909001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pigc sgRNA CRISPR Lentivector set (Rat) |
|
K6625501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PIGC sgRNA CRISPR Lentivector set (Human) |
|
K1646901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Pigc sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4909002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pigc sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4909003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pigc sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4909004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pigc sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6625502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pigc sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6625503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pigc sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6625504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) PIGC sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1646902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PIGC sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1646903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PIGC sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1646904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PIGC Protein Vector (Rat) (pPB-C-His) |
|
PV293962 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PIGC Protein Vector (Rat) (pPB-N-His) |
|
PV293963 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PIGC Protein Vector (Rat) (pPM-C-HA) |
|
PV293964 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PIGC Protein Vector (Rat) (pPM-C-His) |
|
PV293965 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PIGC Protein Vector (Human) (pPB-C-His) |
|
PV031249 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PIGC Protein Vector (Human) (pPB-N-His) |
|
PV031250 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PIGC Protein Vector (Human) (pPM-C-HA) |
|
PV031251 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PIGC Protein Vector (Human) (pPM-C-His) |
|
PV031252 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PIGC Protein Vector (Mouse) (pPB-C-His) |
|
PV216030 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PIGC Protein Vector (Mouse) (pPB-N-His) |
|
PV216031 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PIGC Protein Vector (Mouse) (pPM-C-HA) |
|
PV216032 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PIGC Protein Vector (Mouse) (pPM-C-His) |
|
PV216033 |
ABM |
500 ng |
EUR 603 |
PIGC Protein Vector (Mouse) (pPB-C-His) |
|
PV216034 |
ABM |
500 ng |
EUR 603 |
PIGC Protein Vector (Mouse) (pPB-N-His) |
|
PV216035 |
ABM |
500 ng |
EUR 603 |
PIGC Protein Vector (Mouse) (pPM-C-HA) |
|
PV216036 |
ABM |
500 ng |
EUR 603 |
PIGC Protein Vector (Mouse) (pPM-C-His) |
|
PV216037 |
ABM |
500 ng |
EUR 603 |
 Pigc 3'UTR Luciferase Stable Cell Line |
|
TU116347 |
ABM |
1.0 ml |
Ask for price |
 Pigc 3'UTR GFP Stable Cell Line |
|
TU166347 |
ABM |
1.0 ml |
Ask for price |
Pigc 3'UTR Luciferase Stable Cell Line |
|
TU216226 |
ABM |
1.0 ml |
Ask for price |
Pigc 3'UTR GFP Stable Cell Line |
|
TU266226 |
ABM |
1.0 ml |
Ask for price |
 PIGC 3'UTR GFP Stable Cell Line |
|
TU067929 |
ABM |
1.0 ml |
EUR 1394 |
 PIGC 3'UTR Luciferase Stable Cell Line |
|
TU017929 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) PIGC Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV692587 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) PIGC Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV692591 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) PIGC Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV692592 |
ABM |
1.0 ug DNA |
EUR 514 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
PIGC Rabbit Polyclonal Antibody
