January 18, 2022

STAC3 Rabbit Polyclonal Antibody

STAC3 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

STAC3 Polyclonal Antibody

ES10245-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STAC3 Polyclonal Antibody

ES10245-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAC3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STAC3 antibody

70R-20559 50 ul
EUR 435
Description: Rabbit polyclonal STAC3 antibody

STAC3 Antibody

46233-100ul 100ul
EUR 252

STAC3 Antibody

46233-50ul 50ul
EUR 187

STAC3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC3. Recognizes STAC3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

STAC3 Antibody

DF9900 200ul
EUR 304
Description: STAC3 Antibody detects endogenous levels of total STAC3.

STAC3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STAC3. Recognizes STAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

STAC3 Antibody

ABD9900 100 ug
EUR 438

STAC3 Polyclonal Antibody, Biotin Conjugated

A61167 100 µg
EUR 570.55
Description: reagents widely cited

STAC3 Polyclonal Antibody, FITC Conjugated

A61168 100 µg
EUR 570.55
Description: Ask the seller for details

STAC3 Polyclonal Antibody, HRP Conjugated

A61169 100 µg
EUR 570.55
Description: The best epigenetics products

STAC3 Conjugated Antibody

C46233 100ul
EUR 397

anti- STAC3 antibody

FNab08280 100µg
EUR 548.75
  • Immunogen: SH3 and cysteine rich domain 3
  • Uniprot ID: Q96MF2
  • Gene ID: 246329
  • Research Area: Signal Transduction
Description: Antibody raised against STAC3

Anti-STAC3 antibody

PAab08280 100 ug
EUR 386

Anti-STAC3 antibody

STJ191403 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STAC3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA22788 50 ug
EUR 363
Description: Mouse polyclonal to STAC3

STAC3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC3. Recognizes STAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STAC3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC3. Recognizes STAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STAC3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAC3. Recognizes STAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STAC3 Blocking Peptide

DF9900-BP 1mg
EUR 195

STAC3 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

STAC3 cloning plasmid

CSB-CL839373HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 978
  • Sequence: atggaacttcccccagagccccaggccaatggggaggcagtgggagctgggggtgggcccatctactacatctatgaggaagaggaagaggaagaagaggaggaggaggagccacccccagaacctcctaagctggtcaacgataagccccacaaattcaaagatcacttcttcaa
  • Show more
Description: A cloning plasmid for the STAC3 gene.

Anti-STAC3 (1G8)

YF-MA20055 200 ul
EUR 363
Description: Mouse monoclonal to STAC3


ELI-29859h 96 Tests
EUR 824

Mouse Stac3 ELISA KIT

ELI-29860m 96 Tests
EUR 865


EF003278 96 Tests
EUR 689

Human STAC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse STAC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STAC3 Recombinant Protein (Rat)

RP231299 100 ug Ask for price

STAC3 Recombinant Protein (Human)

RP030274 100 ug Ask for price

STAC3 Recombinant Protein (Mouse)

RP175865 100 ug Ask for price

Stac3 ORF Vector (Rat) (pORF)

ORF077101 1.0 ug DNA
EUR 506

STAC3 ORF Vector (Human) (pORF)

ORF010092 1.0 ug DNA
EUR 95

Stac3 ORF Vector (Mouse) (pORF)

ORF058623 1.0 ug DNA
EUR 506

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody

abx238280-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stac3 sgRNA CRISPR Lentivector set (Rat)

K6398401 3 x 1.0 ug
EUR 339

Stac3 sgRNA CRISPR Lentivector set (Mouse)

K3571501 3 x 1.0 ug
EUR 339

STAC3 sgRNA CRISPR Lentivector set (Human)

K2298001 3 x 1.0 ug
EUR 339

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SH3 And Cysteine Rich Domain 3 (STAC3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Stac3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6398402 1.0 ug DNA
EUR 154

Stac3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6398403 1.0 ug DNA
EUR 154

Stac3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6398404 1.0 ug DNA
EUR 154

STAC3 Rabbit Polyclonal Antibody