PIGP Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 PIGP Polyclonal Antibody |
|
ABP59912-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 |
PIGP Polyclonal Antibody |
|
ES9991-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGP Polyclonal Antibody |
|
ES9991-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 PIGP Rabbit pAb |
|
A15446-100ul |
Abclonal |
100 ul |
EUR 308 |
PIGP Rabbit pAb |
|
A15446-200ul |
Abclonal |
200 ul |
EUR 459 |
PIGP Rabbit pAb |
|
A15446-20ul |
Abclonal |
20 ul |
EUR 183 |
PIGP Rabbit pAb |
|
A15446-50ul |
Abclonal |
50 ul |
EUR 223 |
 PIGP Antibody |
|
46127-100ul |
SAB |
100ul |
EUR 252 |
PIGP Antibody |
|
46127-50ul |
SAB |
50ul |
EUR 187 |
PIGP Antibody |
|
DF9744 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PIGP Antibody detects endogenous levels of total PIGP. |
PIGP Antibody |
|
1-CSB-PA017979LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
 PIGP Conjugated Antibody |
|
C46127 |
SAB |
100ul |
EUR 397 |
 anti- PIGP antibody |
|
FNab06444 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: phosphatidylinositol glycan anchor biosynthesis, class P
- Uniprot ID: P57054
- Gene ID: 51227
- Research Area: Metabolism
|
|
Description: Antibody raised against PIGP |
 Anti-PIGP antibody |
|
STJ117641 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-PIGP antibody |
|
STJ191149 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PIGP |
 PIGP siRNA |
|
20-abx928576 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGP siRNA |
|
20-abx928577 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PIGP Antibody, HRP conjugated |
|
1-CSB-PA017979LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PIGP Antibody, FITC conjugated |
|
1-CSB-PA017979LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PIGP Antibody, Biotin conjugated |
|
1-CSB-PA017979LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PIGP Blocking Peptide |
|
DF9744-BP |
Affbiotech |
1mg |
EUR 195 |
 PIGP cloning plasmid |
|
CSB-CL017979HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 405
- Sequence: atggtggaaaattcaccgtcgccattgccagaaagagcgatttatggctttgttcttttcttaagctcccaatttggcttcatactttacctcgtgtgggcctttattcctgaatcttggctaaactctttaggtttaacctattggcctcaaaaatattgggcagttgcattacc
- Show more
|
|
Description: A cloning plasmid for the PIGP gene. |
) Anti-PIGP (2E7) |
|
YF-MA18446 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PIGP |
 Mouse PIGP shRNA Plasmid |
|
20-abx974629 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PIGP shRNA Plasmid |
|
20-abx959618 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PIGP Recombinant Protein (Human) |
|
RP023473 |
ABM |
100 ug |
Ask for price |
) PIGP Recombinant Protein (Mouse) |
|
RP162053 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
|
RP162056 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
|
RP162059 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
|
RP162062 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
|
RP162065 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
|
RP162068 |
ABM |
100 ug |
Ask for price |
) PIGP Recombinant Protein (Rat) |
|
RP220487 |
ABM |
100 ug |
Ask for price |
 (pORF)) Pigp ORF Vector (Rat) (pORF) |
|
ORF073497 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) PIGP ORF Vector (Human) (pORF) |
|
ORF007825 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pigp ORF Vector (Mouse) (pORF) |
|
ORF054019 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
|
ORF054020 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
|
ORF054021 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
|
ORF054022 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
|
ORF054023 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
|
ORF054024 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody) Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
|
20-abx217767 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
|
abx029081-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
|
abx029081-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
|
abx236444-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
|
20-abx302113 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Pigp sgRNA CRISPR Lentivector set (Rat) |
|
K6548601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pigp sgRNA CRISPR Lentivector set (Mouse) |
|
K3106601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) PIGP sgRNA CRISPR Lentivector set (Human) |
|
K1648001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody (HRP)) Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP) |
|
20-abx314272 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC) |
|
20-abx314273 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin) |
|
20-abx314274 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (Target 1)) Pigp sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6548602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pigp sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6548603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pigp sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6548604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pigp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3106602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pigp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3106603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pigp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3106604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) PIGP sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1648002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PIGP sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1648003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PIGP sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1648004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PIGP Protein Vector (Rat) (pPB-C-His) |
|
PV293986 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PIGP Protein Vector (Rat) (pPB-N-His) |
|
PV293987 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PIGP Protein Vector (Rat) (pPM-C-HA) |
|
PV293988 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PIGP Protein Vector (Rat) (pPM-C-His) |
|
PV293989 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PIGP Protein Vector (Human) (pPB-C-His) |
|
PV031297 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PIGP Protein Vector (Human) (pPB-N-His) |
|
PV031298 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PIGP Protein Vector (Human) (pPM-C-HA) |
|
PV031299 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PIGP Protein Vector (Human) (pPM-C-His) |
|
PV031300 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PIGP Protein Vector (Mouse) (pPB-C-His) |
|
PV216074 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PIGP Protein Vector (Mouse) (pPB-N-His) |
|
PV216075 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PIGP Protein Vector (Mouse) (pPM-C-HA) |
|
PV216076 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PIGP Protein Vector (Mouse) (pPM-C-His) |
|
PV216077 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
|
PV216078 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
|
PV216079 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
|
PV216080 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
|
PV216081 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
|
PV216082 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
|
PV216083 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
|
PV216084 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
|
PV216085 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
|
PV216086 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
|
PV216087 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
|
PV216088 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
|
PV216089 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
|
PV216090 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
|
PV216091 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
|
PV216092 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
|
PV216093 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
|
PV216094 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
|
PV216095 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
|
PV216096 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
|
PV216097 |
ABM |
500 ng |
EUR 603 |
 Pigp 3'UTR Luciferase Stable Cell Line |
|
TU116356 |
ABM |
1.0 ml |
Ask for price |
 Pigp 3'UTR GFP Stable Cell Line |
|
TU166356 |
ABM |
1.0 ml |
Ask for price |
Pigp 3'UTR Luciferase Stable Cell Line |
|
TU216234 |
ABM |
1.0 ml |
Ask for price |
Pigp 3'UTR GFP Stable Cell Line |
|
TU266234 |
ABM |
1.0 ml |
Ask for price |
 PIGP 3'UTR GFP Stable Cell Line |
|
TU067940 |
ABM |
1.0 ml |
EUR 1521 |
 PIGP 3'UTR Luciferase Stable Cell Line |
|
TU017940 |
ABM |
1.0 ml |
EUR 1521 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
PIGP Rabbit Polyclonal Antibody
