October 28, 2021

NASP Rabbit Polyclonal Antibody

NASP Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NASP Polyclonal Antibody

ABP59401-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NASP protein at amino acid sequence of 680-760
  • Applications tips:
Description: A polyclonal antibody for detection of NASP from Human, Mouse, Rat. This NASP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NASP protein at amino acid sequence of 680-760

NASP Rabbit pAb

A3972-100ul 100 ul
EUR 308

NASP Rabbit pAb

A3972-200ul 200 ul
EUR 459

NASP Rabbit pAb

A3972-20ul 20 ul Ask for price

NASP Rabbit pAb

A3972-50ul 50 ul Ask for price

NASP Rabbit pAb

A6938-100ul 100 ul
EUR 308

NASP Rabbit pAb

A6938-200ul 200 ul
EUR 459

NASP Rabbit pAb

A6938-20ul 20 ul
EUR 183

NASP Rabbit pAb

A6938-50ul 50 ul
EUR 223

NASP Antibody

47745-100ul 100ul
EUR 252

NASP antibody

70R-18758 50 ul
EUR 435
Description: Rabbit polyclonal NASP antibody

NASP antibody

70R-2036 50 ug
EUR 467
Description: Rabbit polyclonal NASP antibody

NASP Antibody

DF12166 200ul
EUR 304
Description: NASP antibody detects endogenous levels of NASP.

NASP Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NASP. Recognizes NASP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NASP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NASP. Recognizes NASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Polyclonal NASP Antibody (N-term)

APR05360G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NASP (N-term). This antibody is tested and proven to work in the following applications:

NASP Conjugated Antibody

C47745 100ul
EUR 397

anti- NASP antibody

FNab05559 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: nuclear autoantigenic sperm protein (histone-binding)
  • Uniprot ID: P49321
  • Gene ID: 4678
  • Research Area: Metabolism
Description: Antibody raised against NASP

Anti-NASP antibody

PAab05559 100 ug
EUR 355

Anti-NASP antibody

STJ29018 100 µl
EUR 277
Description: This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa.

Anti-NASP antibody

STJ24684 100 µl
EUR 277
Description: This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa.

Anti-NASP antibody

STJ191088 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NASP

Nasp/ Rat Nasp ELISA Kit

ELI-16054r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NASP cloning plasmid

CSB-CL015462HU-10ug 10ug
EUR 488
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1350
  • Sequence: atggccatggagtccacagccactgccgccgtcgccgcggagctggtttctgccgacaaaattgaagatgttcctgctccttctacatctgcagataaagtggagagtctggatgtggatagtgaagctaagaaactattgggtttaggacagaaacatctggtgatgggggata
  • Show more
Description: A cloning plasmid for the NASP gene.

NASP Blocking Peptide

33R-4313 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NASP antibody, catalog no. 70R-2036

NASP Blocking Peptide

DF12166-BP 1mg
EUR 195

Rabbit Nuclear autoantigenic sperm protein, NASP ELISA KIT

ELI-38390Ra 96 Tests
EUR 928

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

abx032340-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

abx032340-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

abx235559-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nuclear Autoantigenic Sperm Protein (NASP) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP)

Mouse NASP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NASP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001091 96 Tests
EUR 689

Human NASP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NASP Recombinant Protein (Human)

RP020716 100 ug Ask for price

NASP Recombinant Protein (Rat)

RP213299 100 ug Ask for price

NASP Recombinant Protein (Mouse)

RP153110 100 ug Ask for price

NASP Recombinant Protein (Mouse)

RP153113 100 ug Ask for price

ELISA kit for Rabbit Nuclear autoantigenic sperm protein (NASP)

KTE90077-48T 48T
EUR 354
  • Nuclear autoantigenic sperm protein (NASP) encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Nuclear autoantigenic sperm protein (NASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Nuclear autoantigenic sperm protein (NASP)

KTE90077-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Nuclear autoantigenic sperm protein (NASP) encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Nuclear autoantigenic sperm protein (NASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Nuclear autoantigenic sperm protein (NASP)

KTE90077-96T 96T
EUR 572
  • Nuclear autoantigenic sperm protein (NASP) encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Nuclear autoantigenic sperm protein (NASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with APC.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with Biotin.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with Cy3.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with FITC.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with HRP.

Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NASP (Thr3~Asp223)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Autoantigenic Sperm Protein, Histone Binding (NASP). This antibody is labeled with PE.

Rabbit Nuclear autoantigenic sperm protein(NASP) kit ELISA kit

E04N0604-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear autoantigenic sperm protein(NASP) kit in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nuclear autoantigenic sperm protein(NASP) kit ELISA kit

E04N0604-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear autoantigenic sperm protein(NASP) kit in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nuclear autoantigenic sperm protein(NASP) kit ELISA kit

E04N0604-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear autoantigenic sperm protein(NASP) kit in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

NASP ORF Vector (Human) (pORF)

ORF006906 1.0 ug DNA
EUR 95

NASP Rabbit Polyclonal Antibody