October 23, 2021

SPDEF Rabbit Polyclonal Antibody

SPDEF Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SPDEF Polyclonal Antibody
ES10192-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPDEF from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SPDEF Polyclonal Antibody
ABP60490-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SPDEF protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of SPDEF from Human, Mouse. This SPDEF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPDEF protein at amino acid sequence of 140-220
SPDEF Polyclonal Antibody
ABP60490-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SPDEF protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of SPDEF from Human, Mouse. This SPDEF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPDEF protein at amino acid sequence of 140-220
SPDEF Polyclonal Antibody
ABP60490-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SPDEF protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of SPDEF from Human, Mouse. This SPDEF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SPDEF protein at amino acid sequence of 140-220
SPDEF Rabbit pAb
A14114-100ul 100 ul
EUR 308
SPDEF Rabbit pAb
A14114-200ul 200 ul
EUR 459
SPDEF Rabbit pAb
A14114-20ul 20 ul
EUR 183
SPDEF Rabbit pAb
A14114-50ul 50 ul
EUR 223
SPDEF Rabbit pAb
A6747-100ul 100 ul
EUR 308
SPDEF Rabbit pAb
A6747-200ul 200 ul
EUR 459
SPDEF Rabbit pAb
A6747-20ul 20 ul
EUR 183
SPDEF Rabbit pAb
A6747-50ul 50 ul
EUR 223
SPDEF antibody
70R-8298 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SPDEF antibody
SPDEF Antibody
35874-100ul 100ul
EUR 252
SPDEF Antibody
1-CSB-PA874773
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
SPDEF Antibody
1-CSB-PA022518LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
Polyclonal SPDEF antibody - middle region
APR00614G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal SPDEF antibody - N-terminal region
APR00593G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - N-terminal region. This antibody is tested and proven to work in the following applications:
SPDEF Conjugated Antibody
C35874 100ul
EUR 397
Anti-SPDEF antibody
STJ28830 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-SPDEF antibody
STJ191350 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPDEF
Anti-SPDEF antibody
STJ116049 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
SPDEF siRNA
20-abx934902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SPDEF siRNA
20-abx934903
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SPDEF
YF-PA25935 50 ul
EUR 334
Description: Mouse polyclonal to SPDEF
SPDEF Antibody, HRP conjugated
1-CSB-PA022518LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SPDEF Antibody, FITC conjugated
1-CSB-PA022518LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SPDEF Antibody, Biotin conjugated
1-CSB-PA022518LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SPDEF cloning plasmid
CSB-CL022518HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atgggcagcgccagcccgggtctgagcagcgtatcccccagccacctcctgctgccccccgacacggtgtcgcggacaggcttggagaaggcggcagcgggggcagtgggtctcgagagacgggactggagtcccagtccacccgccacgcccgagcagggcctgtccgccttct
  • Show more
Description: A cloning plasmid for the SPDEF gene.
SPDEF Blocking Peptide
33R-2949 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPDEF antibody, catalog no. 70R-8298
Anti-SPDEF (4A5)
YF-MA18002 100 ug
EUR 363
Description: Mouse monoclonal to SPDEF
Mouse SPDEF shRNA Plasmid
20-abx974014
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SPDEF ELISA KIT|Human
EF005474 96 Tests
EUR 689
Human SPDEF ELISA KIT
ELI-52217h 96 Tests
EUR 824
Mouse Spdef ELISA KIT
ELI-42551m 96 Tests
EUR 865
Human SPDEF shRNA Plasmid
20-abx958507
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SPDEF Recombinant Protein (Human)
RP029854 100 ug Ask for price
SPDEF Recombinant Protein (Rat)
RP230720 100 ug Ask for price
SPDEF Recombinant Protein (Mouse)
RP174884 100 ug Ask for price
Monoclonal SPDEF Antibody (monoclonal) (M01), Clone: 4A5
AMM04127G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SPDEF (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A5. This antibody is applicable in WB, E
Spdef ORF Vector (Mouse) (pORF)
ORF058296 1.0 ug DNA
EUR 506
SPDEF ORF Vector (Human) (pORF)
ORF009952 1.0 ug DNA
EUR 95
Spdef ORF Vector (Rat) (pORF)
ORF076908 1.0 ug DNA
EUR 506
pENTR223-SPDEF-599G-C997 vector
PVT11948 2 ug
EUR 308
SPDEF ELISA Kit (Human) (OKCA01500)
OKCA01500 96 Wells
EUR 846
Description: Description of target: May function as an androgen-independent transactivator of the prostate-specific antigen (PSA) promoter. Binds to 5'-GGAT-3' DNA sequences. May play a role in the regulation of the prostate gland and/or prostate cancer development. Acts as a transcriptional activator for SERPINB5 promoter.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL
SPDEF ELISA Kit (Human) (OKEH08557)
OKEH08557 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.35ng/mL
SPDEF ELISA Kit (Mouse) (OKEH08558)
OKEH08558 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156ng/mL
SPDEF sgRNA CRISPR Lentivector set (Human)
K2269901 3 x 1.0 ug
EUR 339
Spdef sgRNA CRISPR Lentivector set (Mouse)
K3873401 3 x 1.0 ug
EUR 339
Spdef sgRNA CRISPR Lentivector set (Rat)
K6696201 3 x 1.0 ug
EUR 339
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody
abx145115-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody
20-abx006389
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody
20-abx317850
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SAM pointed domain-containing Ets transcription factor (SPDEF) Antibody
20-abx212939
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SPDEF sgRNA CRISPR Lentivector (Human) (Target 1)
K2269902 1.0 ug DNA
EUR 154
SPDEF sgRNA CRISPR Lentivector (Human) (Target 2)
K2269903 1.0 ug DNA
EUR 154
SPDEF sgRNA CRISPR Lentivector (Human) (Target 3)
K2269904 1.0 ug DNA
EUR 154
Spdef sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3873402 1.0 ug DNA
EUR 154
Spdef sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3873403 1.0 ug DNA
EUR 154
Spdef sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3873404 1.0 ug DNA
EUR 154
Spdef sgRNA CRISPR Lentivector (Rat) (Target 1)
K6696202 1.0 ug DNA
EUR 154
Spdef sgRNA CRISPR Lentivector (Rat) (Target 2)
K6696203 1.0 ug DNA
EUR 154
Spdef sgRNA CRISPR Lentivector (Rat) (Target 3)
K6696204 1.0 ug DNA
EUR 154
SPDEF Protein Vector (Human) (pPB-C-His)
PV039805 500 ng
EUR 329
SPDEF Protein Vector (Human) (pPB-N-His)
PV039806 500 ng
EUR 329
SPDEF Protein Vector (Human) (pPM-C-HA)
PV039807 500 ng
EUR 329
SPDEF Protein Vector (Human) (pPM-C-His)
PV039808 500 ng
EUR 329
SPDEF Protein Vector (Rat) (pPB-C-His)
PV307630 500 ng
EUR 603
SPDEF Protein Vector (Rat) (pPB-N-His)
PV307631 500 ng
EUR 603
SPDEF Protein Vector (Rat) (pPM-C-HA)
PV307632 500 ng
EUR 603
SPDEF Protein Vector (Rat) (pPM-C-His)
PV307633 500 ng
EUR 603
SPDEF Protein Vector (Mouse) (pPB-C-His)
PV233182 500 ng
EUR 603
SPDEF Protein Vector (Mouse) (pPB-N-His)
PV233183 500 ng
EUR 603
SPDEF Protein Vector (Mouse) (pPM-C-HA)
PV233184 500 ng
EUR 603
SPDEF Protein Vector (Mouse) (pPM-C-His)
PV233185 500 ng
EUR 603
Spdef 3'UTR GFP Stable Cell Line
TU169556 1.0 ml Ask for price
Spdef 3'UTR Luciferase Stable Cell Line
TU119556 1.0 ml Ask for price
SPDEF 3'UTR GFP Stable Cell Line
TU074433 1.0 ml
EUR 1394
SPDEF 3'UTR Luciferase Stable Cell Line
TU024433 1.0 ml
EUR 1394
Spdef 3'UTR Luciferase Stable Cell Line
TU221056 1.0 ml Ask for price
Spdef 3'UTR GFP Stable Cell Line
TU271056 1.0 ml Ask for price
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody (HRP)
20-abx314344
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody (FITC)
20-abx314345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody (Biotin)
20-abx314346
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SPDEF Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV623065 1.0 ug DNA
EUR 514
SPDEF Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV623069 1.0 ug DNA
EUR 514
SPDEF Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV623070 1.0 ug DNA
EUR 514
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

SPDEF Rabbit Polyclonal Antibody