January 17, 2022

NFIX Rabbit Polyclonal Antibody

NFIX Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NFIX Polyclonal Antibody

A64710 100 µg
EUR 570.55
Description: Ask the seller for details

NFIX Polyclonal Antibody

ABP59456-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310

NFIX Polyclonal Antibody

ABP59456-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310

NFIX Polyclonal Antibody

ABP59456-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310

NFIX Polyclonal Antibody

ES9932-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NFIX from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NFIX Polyclonal Antibody

ES9932-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NFIX from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NFIX Polyclonal Conjugated Antibody

C31707 100ul
EUR 397

NFIX Rabbit pAb

A9390-100ul 100 ul
EUR 308

NFIX Rabbit pAb

A9390-200ul 200 ul
EUR 459

NFIX Rabbit pAb

A9390-20ul 20 ul
EUR 183

NFIX Rabbit pAb

A9390-50ul 50 ul
EUR 223

Human Nuclear Factor I/X (NFIX) ELISA Kit

EUR 517
  • Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Human Nuclear Factor I/X (NFIX) ELISA Kit

EUR 673
  • Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

EUR 527
  • Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

EUR 688
  • Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Factor I/X (NFIX) ELISA Kit

EUR 549
  • Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Factor I/X (NFIX) ELISA Kit

EUR 718
  • Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Human Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Hu-48Tests 48 Tests
EUR 544

Human Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Hu-96Tests 96 Tests
EUR 756

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Mu-48Tests 48 Tests
EUR 557

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Mu-96Tests 96 Tests
EUR 774

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Ra-48Tests 48 Tests
EUR 583

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RDR-NFIX-Ra-96Tests 96 Tests
EUR 811

Human Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Hu-48Tests 48 Tests
EUR 521

Human Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Hu-96Tests 96 Tests
EUR 723

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Mu-48Tests 48 Tests
EUR 533

Mouse Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Mu-96Tests 96 Tests
EUR 740

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Ra-48Tests 48 Tests
EUR 557

Rat Nuclear Factor I/X (NFIX) ELISA Kit

RD-NFIX-Ra-96Tests 96 Tests
EUR 775

NFIX Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NFIX Polyclonal Antibody, HRP Conjugated

A64711 100 µg
EUR 570.55
Description: The best epigenetics products

NFIX Polyclonal Antibody, FITC Conjugated

A64712 100 µg
EUR 570.55
Description: kits suitable for this type of research

NFIX Polyclonal Antibody, Biotin Conjugated

A64713 100 µg
EUR 570.55
Description: fast delivery possible

NFIX-Specific Antibody

abx235701-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Anti-NFIX antibody

STJ113639 100 µl
EUR 277
Description: The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene.

Anti-NFIX antibody

STJ191090 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NFIX


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA13434 50 ug
EUR 363
Description: Mouse polyclonal to NFIX

NFIX Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NFIX Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NFIX Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

anti- NFIX-Specific antibody

FNab05701 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: nuclear factor I/X(CCAAT-binding transcription factor)
  • Uniprot ID: Q14938
  • Research Area: Neuroscience, Epigenetics
Description: Antibody raised against NFIX-Specific

Anti-NFIX-Specific antibody

PAab05701 100 ug
EUR 386

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX)

NFIX cloning plasmid

CSB-CL617941HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgctcccggcttgccgcctgcaggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagc
  • Show more
Description: A cloning plasmid for the NFIX gene.

Anti-NFIX (3D2)

YF-MA14438 100 ug
EUR 363
Description: Mouse monoclonal to NFIX


  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFIA/NFIB/NFIC/NFIX. Recognizes NFIA/NFIB/NFIC/NFIX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

NFIA / NFIB / NFIC / NFIX Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with APC.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Biotin.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Cy3.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with FITC.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with HRP.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with PE.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nuclear Factor I/X (NFIX) Antibody

abx122648-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nuclear Factor I/X (NFIX) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NFIX (His13~Thr298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with APC-Cy7.


EF001208 96 Tests
EUR 689

NFIX Rabbit Polyclonal Antibody