January 17, 2022

SPEG Rabbit Polyclonal Antibody

SPEG Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SPEG Polyclonal Antibody
ES10317-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SPEG from Human/Mouse/Rat. This antibody is tested and validated for IHC

Polyclonal APEG1 / SPEG Antibody (internal region)
APG00823G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human APEG1 / SPEG (internal region). This antibody is tested and proven to work in the following applications:

Speg/ Rat Speg ELISA Kit
ELI-52856r 96 Tests
EUR 886

Anti-SPEG antibody
STJ191475 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SPEG

SPEG siRNA
20-abx905239
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SPEG siRNA
20-abx934924
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SPEG siRNA
20-abx934925
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-APEG1 / SPEG antibody
STJ72801 100 µg
EUR 260

SPEG cloning plasmid
CSB-CL623013HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 342
  • Sequence: atgaagcccagtcccagccagaaccgccgttcttctgacactggctccaaggcaccccccaccttcaaggtctcacttatggaccagtcagtaagagaaggccaagatgtcatcatgagcatccgcgtgcagggggagcccaagcctgtggtctcctggctgagaaaccgccagcc
  • Show more
Description: A cloning plasmid for the SPEG gene.

Mouse Speg ELISA KIT
ELI-42553m 96 Tests
EUR 865

Rat SPEG shRNA Plasmid
20-abx990530
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SPEG shRNA Plasmid
20-abx956971
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SPEG shRNA Plasmid
20-abx969178
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SPEG ELISA KIT
ELI-39502h 96 Tests
EUR 824

Speg ORF Vector (Rat) (pORF)
ORF076914 1.0 ug DNA
EUR 3524

Speg ORF Vector (Rat) (pORF)
ORF076915 1.0 ug DNA
EUR 506

h SPEG inducible lentiviral particles
LVP120 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, SPEG, is fully sequence verified and matched to NCBI accession ID: NM_005876

SPEG ORF Vector (Human) (pORF)
ORF009954 1.0 ug DNA
EUR 95

Speg ORF Vector (Mouse) (pORF)
ORF058312 1.0 ug DNA
EUR 3527

Speg ORF Vector (Mouse) (pORF)
ORF058313 1.0 ug DNA
EUR 2744

Speg ORF Vector (Mouse) (pORF)
ORF058314 1.0 ug DNA
EUR 506

Speg ORF Vector (Mouse) (pORF)
ORF058315 1.0 ug DNA
EUR 506

Speg sgRNA CRISPR Lentivector set (Rat)
K7139401 3 x 1.0 ug
EUR 339

Speg sgRNA CRISPR Lentivector set (Mouse)
K3919701 3 x 1.0 ug
EUR 339

SPEG sgRNA CRISPR Lentivector set (Human)
K2271201 3 x 1.0 ug
EUR 339

Speg sgRNA CRISPR Lentivector (Rat) (Target 1)
K7139402 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Rat) (Target 2)
K7139403 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Rat) (Target 3)
K7139404 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3919702 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3919703 1.0 ug DNA
EUR 154

Speg sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3919704 1.0 ug DNA
EUR 154

SPEG sgRNA CRISPR Lentivector (Human) (Target 1)
K2271202 1.0 ug DNA
EUR 154

SPEG sgRNA CRISPR Lentivector (Human) (Target 2)
K2271203 1.0 ug DNA
EUR 154

SPEG sgRNA CRISPR Lentivector (Human) (Target 3)
K2271204 1.0 ug DNA
EUR 154

SPEG Protein Vector (Rat) (pPB-C-His)
PV307654 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPB-N-His)
PV307655 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPM-C-HA)
PV307656 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPM-C-His)
PV307657 500 ng
EUR 5216

SPEG Protein Vector (Rat) (pPB-C-His)
PV307658 500 ng
EUR 603

SPEG Protein Vector (Rat) (pPB-N-His)
PV307659 500 ng
EUR 603

SPEG Protein Vector (Rat) (pPM-C-HA)
PV307660 500 ng
EUR 603

SPEG Protein Vector (Rat) (pPM-C-His)
PV307661 500 ng
EUR 603

SPEG Protein Vector (Human) (pPB-C-His)
PV039813 500 ng
EUR 329

SPEG Protein Vector (Human) (pPB-N-His)
PV039814 500 ng
EUR 329

SPEG Protein Vector (Human) (pPM-C-HA)
PV039815 500 ng
EUR 329

SPEG Protein Vector (Human) (pPM-C-His)
PV039816 500 ng
EUR 329

SPEG Protein Vector (Mouse) (pPB-C-His)
PV233246 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPB-N-His)
PV233247 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPM-C-HA)
PV233248 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPM-C-His)
PV233249 500 ng
EUR 5220

SPEG Protein Vector (Mouse) (pPB-C-His)
PV233250 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPB-N-His)
PV233251 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPM-C-HA)
PV233252 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPM-C-His)
PV233253 500 ng
EUR 4101

SPEG Protein Vector (Mouse) (pPB-C-His)
PV233254 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPB-N-His)
PV233255 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPM-C-HA)
PV233256 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPM-C-His)
PV233257 500 ng
EUR 1065

SPEG Protein Vector (Mouse) (pPB-C-His)
PV233258 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPB-N-His)
PV233259 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPM-C-HA)
PV233260 500 ng
EUR 603

SPEG Protein Vector (Mouse) (pPM-C-His)
PV233261 500 ng
EUR 603

Speg 3'UTR Luciferase Stable Cell Line
TU119570 1.0 ml Ask for price

Speg 3'UTR GFP Stable Cell Line
TU169570 1.0 ml Ask for price

Speg 3'UTR Luciferase Stable Cell Line
TU221061 1.0 ml Ask for price

SPEG 3'UTR GFP Stable Cell Line
TU074446 1.0 ml
EUR 1394

Speg 3'UTR GFP Stable Cell Line
TU271061 1.0 ml Ask for price

SPEG 3'UTR Luciferase Stable Cell Line
TU024446 1.0 ml
EUR 1394

Human Striated muscle preferentially expressed protein kinase (SPEG)
1-CSB-EP022529HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Striated muscle preferentially expressed protein kinase(SPEG),partial expressed in E.coli

SPEG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665917 1.0 ug DNA
EUR 4819

SPEG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665921 1.0 ug DNA
EUR 4819

SPEG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665922 1.0 ug DNA
EUR 4819

SPEG Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV667927 1.0 ug DNA
EUR 514

SPEG Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV667931 1.0 ug DNA
EUR 514

SPEG Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV667932 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

SPEG Rabbit Polyclonal Antibody