October 17, 2021

SHE Rabbit Polyclonal Antibody

SHE Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SHE Polyclonal Antibody
ES10238-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SHE from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
SHE Antibody
1-CSB-PA730142LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHE. Recognizes SHE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
anti- SHE antibody
FNab07845 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: Src homology 2 domain containing E
  • Uniprot ID: Q5VZ18
  • Gene ID: 126669
  • Research Area: Signal Transduction
Description: Antibody raised against SHE
Anti-SHE antibody
PAab07845 100 ug
EUR 386
Anti-SHE antibody
STJ191396 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SHE
SHE siRNA
20-abx933289
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SHE siRNA
20-abx933290
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SHE Antibody, HRP conjugated
1-CSB-PA730142LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHE. Recognizes SHE from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SHE Antibody, FITC conjugated
1-CSB-PA730142LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHE. Recognizes SHE from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SHE Antibody, Biotin conjugated
1-CSB-PA730142LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SHE. Recognizes SHE from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SHE cloning plasmid
CSB-CL730142HU-10ug 10ug
EUR 527
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1488
  • Sequence: atgcagtggtccccgacccctggcgcctctgcgtgtctgggctgggcttcctcgctcgcctgctccacggccccgacgctcctgggccgagccggccggggccccctcatggcggccaagtggttcaaggagttccccctgaacctgaagaccgtgtcggagcgggccaagcccg
  • Show more
Description: A cloning plasmid for the SHE gene.
Mouse SHE shRNA Plasmid
20-abx980871
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SHE shRNA Plasmid
20-abx964878
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SHE ELISA KIT|Human
EF002914 96 Tests
EUR 689
SHE Recombinant Protein (Human)
RP043291 100 ug Ask for price
SHE Recombinant Protein (Mouse)
RP171743 100 ug Ask for price
She ORF Vector (Mouse) (pORF)
ORF057249 1.0 ug DNA
EUR 506
SHE ORF Vector (Human) (pORF)
ORF014431 1.0 ug DNA
EUR 354
Src Homology 2 Domain Containing E (SHE) Antibody
20-abx338806
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Src Homology 2 Domain Containing E (SHE) Antibody
abx237845-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SHE sgRNA CRISPR Lentivector set (Human)
K2143901 3 x 1.0 ug
EUR 339
She sgRNA CRISPR Lentivector set (Mouse)
K4100201 3 x 1.0 ug
EUR 339
Src Homology 2 Domain Containing E (SHE) Antibody (HRP)
20-abx337661
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Src Homology 2 Domain Containing E (SHE) Antibody (FITC)
20-abx337662
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Src Homology 2 Domain Containing E (SHE) Antibody (Biotin)
20-abx337663
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SHE sgRNA CRISPR Lentivector (Human) (Target 1)
K2143902 1.0 ug DNA
EUR 154
SHE sgRNA CRISPR Lentivector (Human) (Target 2)
K2143903 1.0 ug DNA
EUR 154
SHE sgRNA CRISPR Lentivector (Human) (Target 3)
K2143904 1.0 ug DNA
EUR 154
She sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4100202 1.0 ug DNA
EUR 154
She sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4100203 1.0 ug DNA
EUR 154
She sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4100204 1.0 ug DNA
EUR 154
SHE Protein Vector (Human) (pPB-C-His)
PV057721 500 ng
EUR 481
SHE Protein Vector (Human) (pPB-N-His)
PV057722 500 ng
EUR 481
SHE Protein Vector (Human) (pPM-C-HA)
PV057723 500 ng
EUR 481
SHE Protein Vector (Human) (pPM-C-His)
PV057724 500 ng
EUR 481
SHE Protein Vector (Mouse) (pPB-C-His)
PV228994 500 ng
EUR 603
SHE Protein Vector (Mouse) (pPB-N-His)
PV228995 500 ng
EUR 603
SHE Protein Vector (Mouse) (pPM-C-HA)
PV228996 500 ng
EUR 603
SHE Protein Vector (Mouse) (pPM-C-His)
PV228997 500 ng
EUR 603
She 3'UTR GFP Stable Cell Line
TU168783 1.0 ml Ask for price
SHE 3'UTR Luciferase Stable Cell Line
TU023136 1.0 ml
EUR 2333
She 3'UTR Luciferase Stable Cell Line
TU118783 1.0 ml Ask for price
SHE 3'UTR GFP Stable Cell Line
TU073136 1.0 ml
EUR 2333
She 3'UTR Luciferase Stable Cell Line
TU220327 1.0 ml Ask for price
She 3'UTR GFP Stable Cell Line
TU270327 1.0 ml Ask for price
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

SHE Rabbit Polyclonal Antibody