January 17, 2022

NOC4L Rabbit Polyclonal Antibody

NOC4L Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

NOC4L Polyclonal Antibody

ES9950-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOC4L from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOC4L Rabbit pAb

A15509-100ul 100 ul
EUR 308

NOC4L Rabbit pAb

A15509-200ul 200 ul
EUR 459

NOC4L Rabbit pAb

A15509-20ul 20 ul
EUR 183

NOC4L Rabbit pAb

A15509-50ul 50 ul
EUR 223

NOC4L antibody

70R-18912 50 ul
EUR 435
Description: Rabbit polyclonal NOC4L antibody

NOC4L Antibody

44674-100ul 100ul
EUR 252

NOC4L Antibody

44674-50ul 50ul
EUR 187

NOC4L Antibody

DF2218 200ul
EUR 304
Description: NOC4L antibody detects endogenous levels of total NOC4L.

NOC4L Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NOC4L. Recognizes NOC4L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NOC4L antibody

70R-4965 50 ug
EUR 467
Description: Rabbit polyclonal NOC4L antibody

NOC4L Antibody

ABD2218 100 ug
EUR 438

Noc4l/ Rat Noc4l ELISA Kit

ELI-23134r 96 Tests
EUR 886

NOC4L Conjugated Antibody

C44674 100ul
EUR 397

anti- NOC4L antibody

FNab05780 100µg
EUR 505.25
  • Immunogen: nucleolar complex associated 4 homolog(S. cerevisiae)
  • Uniprot ID: Q9BVI4
  • Gene ID: 79050
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against NOC4L

Anti-NOC4L antibody

PAab05780 100 ug
EUR 355

Anti-NOC4L antibody

STJ117704 100 µl
EUR 277

Anti-NOC4L antibody

STJ191108 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOC4L


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA20740 50 ul
EUR 363
Description: Mouse polyclonal to NOC4L

NOC4L Blocking Peptide

33R-1802 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NOC4L antibody, catalog no. 70R-4965

NOC4L Blocking Peptide

DF2218-BP 1mg
EUR 195

NOC4L cloning plasmid

CSB-CL863131HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1551
  • Sequence: atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcgggg
  • Show more
Description: A cloning plasmid for the NOC4L gene.

NOC4L cloning plasmid

CSB-CL863131HU2-10ug 10ug
EUR 544
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1551
  • Sequence: atggagcgggagccgggcgccgcgggagttcgccgggctctgggccgccggctggaggcggtgctggcgagccgcagtgaggccaacgccgtgttcgacatcctggccgtgctgcagtctgaggaccaggaggagatccaggaagcagtccgcacgtgcagccgtcttttcgggg
  • Show more
Description: A cloning plasmid for the NOC4L gene.


EF001271 96 Tests
EUR 689

Rat NOC4L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NOC4L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOC4L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOC4L Recombinant Protein (Human)

RP021412 100 ug Ask for price

NOC4L Recombinant Protein (Human)

RP021415 100 ug Ask for price

NOC4L Recombinant Protein (Mouse)

RP154484 100 ug Ask for price

NOC4L Recombinant Protein (Rat)

RP214175 100 ug Ask for price

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody

abx146256-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleolar Complex Associated 4 Homolog (NOC4L) Antibody

abx235780-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Noc4l ORF Vector (Rat) (pORF)

ORF071393 1.0 ug DNA
EUR 506

NOC4L ORF Vector (Human) (pORF)

ORF007138 1.0 ug DNA
EUR 95

NOC4L ORF Vector (Human) (pORF)

ORF007139 1.0 ug DNA
EUR 95

Noc4l ORF Vector (Mouse) (pORF)

ORF051496 1.0 ug DNA
EUR 506

Noc4l sgRNA CRISPR Lentivector set (Rat)

K6263201 3 x 1.0 ug
EUR 339

Noc4l sgRNA CRISPR Lentivector set (Mouse)

K4115001 3 x 1.0 ug
EUR 339

NOC4L sgRNA CRISPR Lentivector set (Human)

K1438401 3 x 1.0 ug
EUR 339

Noc4l sgRNA CRISPR Lentivector (Rat) (Target 1)

K6263202 1.0 ug DNA
EUR 154

Noc4l sgRNA CRISPR Lentivector (Rat) (Target 2)

K6263203 1.0 ug DNA
EUR 154

Noc4l sgRNA CRISPR Lentivector (Rat) (Target 3)

K6263204 1.0 ug DNA
EUR 154

Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4115002 1.0 ug DNA
EUR 154

Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4115003 1.0 ug DNA
EUR 154

Noc4l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4115004 1.0 ug DNA
EUR 154

NOC4L sgRNA CRISPR Lentivector (Human) (Target 1)

K1438402 1.0 ug DNA
EUR 154

NOC4L sgRNA CRISPR Lentivector (Human) (Target 2)

K1438403 1.0 ug DNA
EUR 154

NOC4L sgRNA CRISPR Lentivector (Human) (Target 3)

K1438404 1.0 ug DNA
EUR 154

NOC4L Protein Vector (Mouse) (pPB-C-His)

PV205982 500 ng
EUR 603

NOC4L Protein Vector (Mouse) (pPB-N-His)

PV205983 500 ng
EUR 603

NOC4L Protein Vector (Mouse) (pPM-C-HA)

PV205984 500 ng
EUR 603

NOC4L Protein Vector (Mouse) (pPM-C-His)

PV205985 500 ng
EUR 603

NOC4L Protein Vector (Rat) (pPB-C-His)

PV285570 500 ng
EUR 603

NOC4L Protein Vector (Rat) (pPB-N-His)

PV285571 500 ng
EUR 603

NOC4L Protein Vector (Rat) (pPM-C-HA)

PV285572 500 ng
EUR 603

NOC4L Protein Vector (Rat) (pPM-C-His)

PV285573 500 ng
EUR 603

NOC4L Protein Vector (Human) (pPB-C-His)

PV028549 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPB-N-His)

PV028550 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPM-C-HA)

PV028551 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPM-C-His)

PV028552 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPB-C-His)

PV028553 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPB-N-His)

PV028554 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPM-C-HA)

PV028555 500 ng
EUR 329

NOC4L Protein Vector (Human) (pPM-C-His)

PV028556 500 ng
EUR 329

Noc4l 3'UTR Luciferase Stable Cell Line

TU114189 1.0 ml Ask for price

Noc4l 3'UTR GFP Stable Cell Line

TU164189 1.0 ml Ask for price

Noc4l 3'UTR Luciferase Stable Cell Line

TU214063 1.0 ml Ask for price

Noc4l 3'UTR GFP Stable Cell Line

TU264063 1.0 ml Ask for price

NOC4L 3'UTR GFP Stable Cell Line

TU065799 1.0 ml
EUR 1394

NOC4L 3'UTR Luciferase Stable Cell Line

TU015799 1.0 ml
EUR 1394

NOC4L Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712791 1.0 ug DNA
EUR 316

NOC4L Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712795 1.0 ug DNA
EUR 316

NOC4L Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712796 1.0 ug DNA
EUR 316

NOC4L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV689905 1.0 ug DNA
EUR 682

NOC4L Rabbit Polyclonal Antibody