October 28, 2021

SYT5 Rabbit Polyclonal Antibody

SYT5 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

SYT5 Polyclonal Antibody

ABP60577-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYT5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of SYT5 from Human, Mouse, Rat. This SYT5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYT5 protein

SYT5 Polyclonal Antibody

ES10336-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SYT5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT5 Polyclonal Antibody

ES10336-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYT5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SYT5 Rabbit pAb

A15321-100ul 100 ul
EUR 308

SYT5 Rabbit pAb

A15321-200ul 200 ul
EUR 459

SYT5 Rabbit pAb

A15321-20ul 20 ul
EUR 183

SYT5 Rabbit pAb

A15321-50ul 50 ul
EUR 223

Polyclonal SYT5 Antibody (Center)

APR10369G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SYT5 (Center). This antibody is tested and proven to work in the following applications:

SYT5 Antibody

35936-100ul 100ul
EUR 252

SYT5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT5. Recognizes SYT5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

SYT5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SYT5. Recognizes SYT5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

SYT5 antibody

70R-9792 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal SYT5 antibody

Syt5/ Rat Syt5 ELISA Kit

ELI-41704r 96 Tests
EUR 886

SYT5 Conjugated Antibody

C35936 100ul
EUR 397

Anti-SYT5 antibody

STJ117516 100 µl
EUR 277

Anti-SYT5 antibody

STJ191494 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYT5


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Synaptotagmin 5 (SYT5) Antibody

abx027780-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Synaptotagmin 5 (SYT5) Antibody

abx027780-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Synaptotagmin 5 (SYT5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 5 (SYT5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Synaptotagmin 5 (SYT5) Antibody

abx146115-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Synaptotagmin-5 (Syt5) Antibody

abx431969-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

SYT5 Blocking Peptide

33R-10175 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SYT5 antibody, catalog no. 70R-9792

SYT5 cloning plasmid

CSB-CL023041HU-10ug 10ug
EUR 434
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1161
  • Sequence: atgttcccggagcccccaaccccggggcctccatcgcccgacacgcctcccgactccagtcgcatcagccacggcccagtgcccccctgggccctggccaccatcgtgctggtctcaggcctcctcatcttcagctgctgtttctgtctctaccggaagagctgtcggaggcgga
  • Show more
Description: A cloning plasmid for the SYT5 gene.

SYT5 protein (His tag)

80R-3523 50 ug
EUR 327
Description: Purified recombinant SYT5 protein (His tag)

Mouse SYT5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SYT5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Synaptotagmin 5 (SYT5) Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Human SYT5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SYT5 Recombinant Protein (Rat)

RP231992 100 ug Ask for price

SYT5 Recombinant Protein (Human)

RP030787 100 ug Ask for price

SYT5 Recombinant Protein (Mouse)

RP176891 100 ug Ask for price

Syt5 ORF Vector (Rat) (pORF)

ORF077332 1.0 ug DNA
EUR 506

SYT5 ORF Vector (Human) (pORF)

ORF010263 1.0 ug DNA
EUR 95

Syt5 ORF Vector (Mouse) (pORF)

ORF058965 1.0 ug DNA
EUR 506

Human Synaptotagmin V (SYT5)ELISA Kit

201-12-2570 96 tests
EUR 440
  • This Synaptotagmin V ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Mouse Synaptotagmin- 5, Syt5 ELISA KIT

ELI-29333m 96 Tests
EUR 865

Human Synaptotagmin- 5, SYT5 ELISA KIT

ELI-46283h 96 Tests
EUR 824

Syt5 sgRNA CRISPR Lentivector set (Rat)

K6909001 3 x 1.0 ug
EUR 339

Syt5 sgRNA CRISPR Lentivector set (Mouse)

K3740701 3 x 1.0 ug
EUR 339

SYT5 sgRNA CRISPR Lentivector set (Human)

K2322901 3 x 1.0 ug
EUR 339

SYT5 Synaptotagmin V Human Recombinant Protein

PROTO00445 Regular: 10ug
EUR 317
Description: SYT5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 301 amino acids (109-386aa) and having a molecular mass of 33.6kDa.

Human Synaptotagmin V(SYT5)ELISA Kit

QY-E01189 96T
EUR 361

ELISA kit for Rat Synaptotagmin-5 (SYT5)

KTE100162-48T 48T
EUR 332
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as nega
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-5 (SYT5)

KTE100162-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as nega
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Synaptotagmin-5 (SYT5)

KTE100162-96T 96T
EUR 539
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C (see MIM 176960) regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as nega
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Syt5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6909002 1.0 ug DNA
EUR 154

Syt5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6909003 1.0 ug DNA
EUR 154

Syt5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6909004 1.0 ug DNA
EUR 154

Syt5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3740702 1.0 ug DNA
EUR 154

Syt5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3740703 1.0 ug DNA
EUR 154

Syt5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3740704 1.0 ug DNA
EUR 154

SYT5 sgRNA CRISPR Lentivector (Human) (Target 1)

K2322902 1.0 ug DNA
EUR 154

SYT5 sgRNA CRISPR Lentivector (Human) (Target 2)

K2322903 1.0 ug DNA
EUR 154

SYT5 sgRNA CRISPR Lentivector (Human) (Target 3)

K2322904 1.0 ug DNA
EUR 154

ELISA kit for Human Synaptotagmin-5 (SYT5)

KTE60436-48T 48T
EUR 332
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-5 (SYT5)

KTE60436-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Synaptotagmin-5 (SYT5)

KTE60436-96T 96T
EUR 539
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-5 (SYT5)

KTE70306-48T 48T
EUR 332
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-5 (SYT5)

KTE70306-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Synaptotagmin-5 (SYT5)

KTE70306-96T 96T
EUR 539
  • Synaptotagmins, such as SYT5, are a family of type III membrane proteins characterized by cytoplasmic repeats related to protein kinase C regulatory (C2) domains, which are thought to bind calcium. Synaptotagmins may act both as negative regulators o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Synaptotagmin-5 (SYT5) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

SYT5 Protein Vector (Rat) (pPB-C-His)

PV309326 500 ng
EUR 603

SYT5 Protein Vector (Rat) (pPB-N-His)

PV309327 500 ng
EUR 603

SYT5 Protein Vector (Rat) (pPM-C-HA)

PV309328 500 ng
EUR 603

SYT5 Protein Vector (Rat) (pPM-C-His)

PV309329 500 ng
EUR 603

SYT5 Protein Vector (Human) (pPB-C-His)

PV041049 500 ng
EUR 329

SYT5 Protein Vector (Human) (pPB-N-His)

PV041050 500 ng
EUR 329

SYT5 Protein Vector (Human) (pPM-C-HA)

PV041051 500 ng
EUR 329

SYT5 Protein Vector (Human) (pPM-C-His)

PV041052 500 ng
EUR 329

SYT5 Protein Vector (Mouse) (pPB-C-His)

PV235858 500 ng
EUR 603

SYT5 Protein Vector (Mouse) (pPB-N-His)

PV235859 500 ng
EUR 603

SYT5 Protein Vector (Mouse) (pPM-C-HA)

PV235860 500 ng
EUR 603

SYT5 Protein Vector (Mouse) (pPM-C-His)

PV235861 500 ng
EUR 603

Recombinant Human SYT5 Protein, His, E.coli-10ug

QP13662-10ug 10ug
EUR 201

Recombinant Human SYT5 Protein, His, E.coli-1mg

QP13662-1mg 1mg
EUR 5251

Recombinant Human SYT5 Protein, His, E.coli-2ug

QP13662-2ug 2ug
EUR 155

Syt5 3'UTR Luciferase Stable Cell Line

TU120046 1.0 ml Ask for price

Syt5 3'UTR GFP Stable Cell Line

TU170046 1.0 ml Ask for price

Syt5 3'UTR Luciferase Stable Cell Line

TU221492 1.0 ml Ask for price

SYT5 3'UTR GFP Stable Cell Line

TU075025 1.0 ml
EUR 1394

Syt5 3'UTR GFP Stable Cell Line

TU271492 1.0 ml Ask for price

SYT5 3'UTR Luciferase Stable Cell Line

TU025025 1.0 ml
EUR 1394

SYT5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695107 1.0 ug DNA
EUR 682

SYT5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695111 1.0 ug DNA
EUR 682

SYT5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695112 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

SYT5 Rabbit Polyclonal Antibody