October 17, 2021

RAB28 Rabbit Polyclonal Antibody

RAB28 Rabbit Polyclonal Antibody

To Order Contact us: [email protected]

RAB28 Polyclonal Antibody

ABP60064-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB28 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB28 from Human, Mouse, Rat. This RAB28 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB28 protein at amino acid sequence of 80-160

RAB28 Polyclonal Antibody

ABP60064-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB28 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB28 from Human, Mouse, Rat. This RAB28 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB28 protein at amino acid sequence of 80-160

RAB28 Polyclonal Antibody

ABP60064-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB28 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB28 from Human, Mouse, Rat. This RAB28 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB28 protein at amino acid sequence of 80-160

RAB28 Rabbit pAb

A17368-100ul 100 ul
EUR 308

RAB28 Rabbit pAb

A17368-200ul 200 ul
EUR 459

RAB28 Rabbit pAb

A17368-20ul 20 ul
EUR 183

RAB28 Rabbit pAb

A17368-50ul 50 ul
EUR 223

Polyclonal RAB28 Antibody (Center)

AMM08671G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB28 (Center). This antibody is tested and proven to work in the following applications:

RAB28 Antibody

ABD9823 100 ug
EUR 438

RAB28 Antibody

46181-100ul 100ul
EUR 252

RAB28 Antibody

46181-50ul 50ul
EUR 187

RAB28 Antibody

DF9823 200ul
EUR 304
Description: RAB28 Antibody detects endogenous levels of total RAB28.

RAB28 Antibody

1-CSB-PA019179LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB28. Recognizes RAB28 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Rab28/ Rat Rab28 ELISA Kit

ELI-36818r 96 Tests
EUR 886

RAB28 Conjugated Antibody

C46181 100ul
EUR 397

RAB28 Antibody (HRP)

20-abx314284
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB28 Antibody (FITC)

20-abx314285
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB28 Antibody (Biotin)

20-abx314286
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-RAB28 antibody

STJ119494 100 µl
EUR 277
Description: This gene encodes a member of the Rab subfamily of Ras-related small GTPases. The encoded protein may be involved in regulating intracellular trafficking. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 9 and X.

Anti-Rab28 antibody

STJ140079 150 µg
EUR 231
Description: RAB28 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking.

Anti-RAB28 antibody

STJ191278 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB28

RAB28 siRNA

20-abx904420
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB28 siRNA

20-abx930632
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB28 siRNA

20-abx930633
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RAB28

YF-PA16246 50 ug
EUR 363
Description: Mouse polyclonal to RAB28

RAB28 Antibody, HRP conjugated

1-CSB-PA019179LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB28. Recognizes RAB28 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB28 Antibody, FITC conjugated

1-CSB-PA019179LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB28. Recognizes RAB28 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB28 Antibody, Biotin conjugated

1-CSB-PA019179LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB28. Recognizes RAB28 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB28 cloning plasmid

CSB-CL019179HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 666
  • Sequence: atgtcggactctgaggaggagagtcaggaccggcaactgaaaatcgtcgtgctgggggacggcgcctccgggaagacctccttaactacgtgttttgctcaagaaacttttgggaaacagtacaaacaaactataggactggatttctttttgagaaggataacattgccaggaaa
  • Show more
Description: A cloning plasmid for the RAB28 gene.

RAB28 cloning plasmid

CSB-CL019179HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atgtcggactctgaggaggagagccaggaccggcaactgaaaatcgtcgtgctgggggacggcgcctccgggaagacctccttaactacgtgttttgctcaagaaacttttgggaaacagtacaaacaaactataggactggatttctttttgagaaggataacattgccaggaaa
  • Show more
Description: A cloning plasmid for the RAB28 gene.

RAB28 Blocking Peptide

DF9823-BP 1mg
EUR 195

pBluescriptR-RAB28 Plasmid

PVT17000 2 ug
EUR 325

Anti-RAB28 (2C6)

YF-MA16804 100 ug
EUR 363
Description: Mouse monoclonal to RAB28

Mouse RAB28 shRNA Plasmid

20-abx979470
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAB28 shRNA Plasmid

20-abx987392
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB28 shRNA Plasmid

20-abx956200
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB28 Recombinant Protein (Human)

RP025453 100 ug Ask for price

RAB28 Recombinant Protein (Human)

RP025456 100 ug Ask for price

RAB28 Recombinant Protein (Rat)

RP223295 100 ug Ask for price

RAB28 Recombinant Protein (Mouse)

RP166250 100 ug Ask for price

Ras-Related Protein Rab-28 (RAB28) Antibody

abx029198-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-28 (RAB28) Antibody

abx029198-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-28 (RAB28) Antibody

20-abx218117
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-28 (RAB28) Antibody

20-abx302115
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB28 ORF Vector (Human) (pORF)

ORF008485 1.0 ug DNA
EUR 95

RAB28 ORF Vector (Human) (pORF)

ORF008486 1.0 ug DNA
EUR 95

Rab28 ORF Vector (Rat) (pORF)

ORF074433 1.0 ug DNA
EUR 506

Rab28 ORF Vector (Mouse) (pORF)

ORF055418 1.0 ug DNA
EUR 506

RAB28 sgRNA CRISPR Lentivector set (Human)

K1773101 3 x 1.0 ug
EUR 339

Rab28 sgRNA CRISPR Lentivector set (Mouse)

K4052601 3 x 1.0 ug
EUR 339

Rab28 sgRNA CRISPR Lentivector set (Rat)

K6950301 3 x 1.0 ug
EUR 339

RAB28 sgRNA CRISPR Lentivector (Human) (Target 1)

K1773102 1.0 ug DNA
EUR 154

RAB28 sgRNA CRISPR Lentivector (Human) (Target 2)

K1773103 1.0 ug DNA
EUR 154

RAB28 sgRNA CRISPR Lentivector (Human) (Target 3)

K1773104 1.0 ug DNA
EUR 154

Rab28 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4052602 1.0 ug DNA
EUR 154

Rab28 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4052603 1.0 ug DNA
EUR 154

Rab28 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4052604 1.0 ug DNA
EUR 154

Rab28 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6950302 1.0 ug DNA
EUR 154

Rab28 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6950303 1.0 ug DNA
EUR 154

Rab28 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6950304 1.0 ug DNA
EUR 154

RAB28 Protein Vector (Human) (pPB-C-His)

PV033937 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPB-N-His)

PV033938 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPM-C-HA)

PV033939 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPM-C-His)

PV033940 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPB-C-His)

PV033941 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPB-N-His)

PV033942 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPM-C-HA)

PV033943 500 ng
EUR 329

RAB28 Protein Vector (Human) (pPM-C-His)

PV033944 500 ng
EUR 329

RAB28 Protein Vector (Rat) (pPB-C-His)

PV297730 500 ng
EUR 603

RAB28 Protein Vector (Rat) (pPB-N-His)

PV297731 500 ng
EUR 603

RAB28 Protein Vector (Rat) (pPM-C-HA)

PV297732 500 ng
EUR 603

RAB28 Protein Vector (Rat) (pPM-C-His)

PV297733 500 ng
EUR 603

RAB28 Protein Vector (Mouse) (pPB-C-His)

PV221670 500 ng
EUR 603

RAB28 Protein Vector (Mouse) (pPB-N-His)

PV221671 500 ng
EUR 603

RAB28 Protein Vector (Mouse) (pPM-C-HA)

PV221672 500 ng
EUR 603

RAB28 Protein Vector (Mouse) (pPM-C-His)

PV221673 500 ng
EUR 603

Rab28 3'UTR GFP Stable Cell Line

TU167406 1.0 ml Ask for price

RAB28 3'UTR Luciferase Stable Cell Line

TU019382 1.0 ml
EUR 1394

RAB28 Rabbit Polyclonal Antibody