SOCS5 Rabbit Polyclonal Antibody
To Order Contact us: [email protected]
 SOCS5 Polyclonal Antibody |
|
ABP60460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SOCS5 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of SOCS5 from Human, Mouse. This SOCS5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SOCS5 protein |
 SOCS5 Rabbit pAb |
|
A7952-100ul |
Abclonal |
100 ul |
EUR 308 |
SOCS5 Rabbit pAb |
|
A7952-200ul |
Abclonal |
200 ul |
EUR 459 |
SOCS5 Rabbit pAb |
|
A7952-20ul |
Abclonal |
20 ul |
EUR 183 |
SOCS5 Rabbit pAb |
|
A7952-50ul |
Abclonal |
50 ul |
EUR 223 |
 SOCS5 Antibody |
|
35923-100ul |
SAB |
100ul |
EUR 252 |
 SOCS5 antibody |
|
22879-100ul |
SAB |
100ul |
EUR 390 |
SOCS5 antibody |
|
70R-20450 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal SOCS5 antibody |
SOCS5 antibody |
|
70R-12836 |
Fitzgerald |
100 ul |
EUR 457 |
|
Description: Affinity purified Rabbit polyclonal SOCS5 antibody |
SOCS5 Antibody |
|
1-CSB-PA796488 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
SOCS5 Antibody |
|
1-CSB-PA446167 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
SOCS5 Antibody |
|
1-CSB-PA022394ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SOCS5 Antibody |
|
1-CSB-PA022394ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
SOCS5 Antibody |
|
1-CSB-PA022394GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against SOCS5. Recognizes SOCS5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
) Polyclonal SOCS5 Antibody (N-Term) |
|
AMM07935G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SOCS5 (N-Term). This antibody is tested and proven to work in the following applications: |
 SOCS5 Conjugated Antibody |
|
C35923 |
SAB |
100ul |
EUR 397 |
 Anti-SOCS5 Antibody |
|
A05989-1 |
BosterBio |
100ug/vial |
EUR 294 |
 Anti-SOCS5 antibody |
|
STJ110261 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported. |
Anti-SOCS5 antibody |
|
STJ191478 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to SOCS5 |
 SOCS5 siRNA |
|
20-abx934654 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SOCS5 siRNA |
|
20-abx934655 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-SOCS5 |
|
YF-PA16462 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to SOCS5 |
anti-SOCS5 |
|
YF-PA16463 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to SOCS5 |
anti-SOCS5 |
|
YF-PA16464 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to SOCS5 |
anti-SOCS5 |
|
YF-PA16465 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to SOCS5 |
anti-SOCS5 |
|
YF-PA25389 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to SOCS5 |
 SOCS5 cloning plasmid |
|
CSB-CL022394HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1611
- Sequence: atggataaagtgggaaaaatgtggaataacttcaaatacaggtgtcagaatctcttcggtcatgagggaggaagccgtagtgaaaatgtggacatgaactccaacagatgtttgtctgtcaaagagaaaaacatcagcataggagactcaactcctcagcaacaaagcagtccct
- Show more
|
|
Description: A cloning plasmid for the SOCS5 gene. |
) Anti-SOCS5 (2D1) |
|
YF-MA11196 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to SOCS5 |
 Mouse SOCS5 shRNA Plasmid |
|
20-abx974795 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human SOCS5 shRNA Plasmid |
|
20-abx956432 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) SOCS5 Recombinant Protein (Human) |
|
RP029677 |
ABM |
100 ug |
Ask for price |
) SOCS5 Recombinant Protein (Rat) |
|
RP230447 |
ABM |
100 ug |
Ask for price |
) SOCS5 Recombinant Protein (Mouse) |
|
RP174455 |
ABM |
100 ug |
Ask for price |
 (M01), Clone: 2D1) Monoclonal SOCS5 Antibody (monoclonal) (M01), Clone: 2D1 |
|
AMM07934G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human SOCS5 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2D1. This antibody is applicable in WB and IHC, E |
 Antibody) Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
20-abx115908 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
abx122789-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
20-abx006047 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
20-abx321293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
20-abx322069 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
abx432015-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Suppressor of Cytokine Signaling 5 (SOCS5) Antibody |
|
abx238101-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 Antibody) Suppressor Of Cytokine Signaling 5 (SOCS5) Antibody |
|
20-abx212667 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Suppressor Of Cytokine Signaling 5 (SOCS5) Antibody |
|
20-abx212937 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) Socs5 ORF Vector (Mouse) (pORF) |
|
ORF058153 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) SOCS5 ORF Vector (Human) (pORF) |
|
ORF009893 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Socs5 ORF Vector (Rat) (pORF) |
|
ORF076817 |
ABM |
1.0 ug DNA |
EUR 506 |
) SOCS5 sgRNA CRISPR Lentivector set (Human) |
|
K2257501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Socs5 sgRNA CRISPR Lentivector set (Mouse) |
|
K3953101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Socs5 sgRNA CRISPR Lentivector set (Rat) |
|
K6752101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) SOCS5 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2257502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) SOCS5 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2257503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) SOCS5 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2257504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3953102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3953103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Socs5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3953104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Socs5 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6752102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Socs5 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6752103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Socs5 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6752104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) SOCS5 Protein Vector (Human) (pPB-C-His) |
|
PV039569 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) SOCS5 Protein Vector (Human) (pPB-N-His) |
|
PV039570 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) SOCS5 Protein Vector (Human) (pPM-C-HA) |
|
PV039571 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) SOCS5 Protein Vector (Human) (pPM-C-His) |
|
PV039572 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) SOCS5 Protein Vector (Rat) (pPB-C-His) |
|
PV307266 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SOCS5 Protein Vector (Rat) (pPB-N-His) |
|
PV307267 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SOCS5 Protein Vector (Rat) (pPM-C-HA) |
|
PV307268 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SOCS5 Protein Vector (Rat) (pPM-C-His) |
|
PV307269 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) SOCS5 Protein Vector (Mouse) (pPB-C-His) |
|
PV232610 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) SOCS5 Protein Vector (Mouse) (pPB-N-His) |
|
PV232611 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) SOCS5 Protein Vector (Mouse) (pPM-C-HA) |
|
PV232612 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) SOCS5 Protein Vector (Mouse) (pPM-C-His) |
|
PV232613 |
ABM |
500 ng |
EUR 603 |
 Socs5 3'UTR GFP Stable Cell Line |
|
TU169455 |
ABM |
1.0 ml |
Ask for price |
 Socs5 3'UTR Luciferase Stable Cell Line |
|
TU119455 |
ABM |
1.0 ml |
Ask for price |
 SOCS5 3'UTR GFP Stable Cell Line |
|
TU074307 |
ABM |
1.0 ml |
EUR 2333 |
 SOCS5 3'UTR Luciferase Stable Cell Line |
|
TU024307 |
ABM |
1.0 ml |
EUR 2333 |
Socs5 3'UTR Luciferase Stable Cell Line |
|
TU220959 |
ABM |
1.0 ml |
Ask for price |
Socs5 3'UTR GFP Stable Cell Line |
|
TU270959 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) SOCS5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV624757 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) SOCS5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV624761 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) SOCS5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV624762 |
ABM |
1.0 ug DNA |
EUR 682 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SOCS5 Rabbit Polyclonal Antibody
